Нажмите "Enter", чтобы перейти к содержанию

Глобальная скорость: Speedtest от Ookla — Глобальный тест скорости широкополосного доступа

Содержание

глобальная карта ветров, погодных условий и морских течений

Дата

⇄ Local UTC Change Timezone

Управление

Сейчас Текущее состояние Choose Date

Сетка Наложить сетку Пуск/Остановка анимации HD Режим высокого разрешения Текущее местонахождение

Mode

Атмосфера Air Mode Океан Ocean Mode Химия Atmospheric Chemistry Mode Аэрозоли Particulates Mode Space Space Weather Mode Bio Biology Mode

Анимация

Ветер Wind Animation Течения Ocean Surface Currents Animation Волны Peak Wave Period Animation

Высота

Поверхн Поверхность 1000 1000 hectopascals 850 850 hectopascals 700 700 hectopascals 500 500 hectopascals 250 250 hectopascals 70 70 hectopascals 10 10 hectopascals

hPa

Наложение

Ветер Скорость ветра Темп. Температура ОВ Относительная Влажность ПЭВ Мгновенная плотность энергии ветра ТСО Трёхчасовые суммы осадков ДКПЭ Доступная конвективная потенциальная энергия TPW Осажденная вода СВО Содержание влаги в облаках MSLP Давление на уровне моря MI Индекс дискомфорта UVI Ultraviolet Index and Erythemal Dose Rate Пусто No Overlay

Наложение

Течения Океанические течения Волны Преобладающий период волн ЗВВ Значительная высота волны ТПМ Температура поверхности моря ТАПМ Температурные аномалии поверхности моря BAA Bleaching Alert Area Пусто No Overlay

Наложение

СОнп концентрация СО на поверхности СО2нп концентрация двуокиси углерода на поверхности SO2нп содержание двуокиси серы на поверхности NO

2 Nitrogen Dioxide

Наложение

Пыль Экстинкция света по Пыль (Оценка плотности оптических частиц, 550 нм) PM1 Particulate Matter < 1 µm PM2.5 Particulate Matter < 2.5 µm PM

10 Particulate Matter < 10 µm SO4эс Экстинкция сульфатами (Оптическая толщина аэрозолей, 550 нм)

Наложение

Aurora Probability of Visible Aurora

Наложение

BAA Bleaching Alert Area Пусто No Annotations

Annotation

Fires Active Fires Пусто No Annotations

Проекция

A Атлантическая проекция CE Коническая эквидистанта E Равнопромежуточная O Ортографическая P Проекция Паттерсона S Стереографическая WB «Бабочка» Уотермана W3 Тройная проекция Винкеля

Тестирование подключений к глобальной сети для архитектур SharePoint 2013 — SharePoint Server

  • Чтение занимает 10 мин

В этой статье

ПРИМЕНЯЕТСЯ К: 2013 2016 2019 Microsoft 365

SharePoint Server 2013 оптимизирован для эффективной работы при WAN-подключениях. В этой статье описаны улучшения производительности и методы тестирования WAN-подключений, чтобы помочь вам определить, есть ли необходимость в географическом развертывании нескольких ферм. Кроме того, приводятся примеры результатов тестирования от компаний, задействованных в программе предварительного выпуска.

Ключевые понятия

  • Полоса пропускания — пропускная способность (или скорость) передачи данных цифровой системы связи, измеряемая в битах в секунду (бит/с).

  • Задержка — время, необходимое для передачи запроса от одной точки в сети к другой.

  • Перегрузка сети состояние сети, при котором в определенном месте в сети текущая нагрузка достигает размера полосы пропускания или доступных ресурсов, предназначенных для работы с такой нагрузкой (или превышает их). Перегрузка может вызывать задержки и потери пакетов.

Улучшение производительности WAN-подключения

SharePoint Server 2013 отвечает на входящие запросы на 50 % быстрее, чем предыдущая версия. Доступная полоса пропускания между сервером и клиентом используется ею почти на 40 % эффективнее, чем предыдущей версией. Эти показатели производительности были получены в среде Майкрософт с самым интенсивным в мире использованием ферм SharePoint.

Для Microsoft 365 среды требуются более высокие уровни производительности по подключению WAN, так как многие клиенты распределены географически. В результате Microsoft 365 была тщательно протестирована в условиях WAN. Тестовые сценарии включали задержки до 300 миллисекунд, что значительно превышает задержки между Северной Америкой и Азией.

Чтобы на 40 % улучшить использование доступной полосы пропускания (по сравнению с предыдущей версией), были оптимизированы различные уровни сетевого стека:

  • повышена эффективность сжатия IIS и сжатия изображений на стороне сервера;

  • серверы намного быстрее отвечают на HTTP- и HTTPS-запросы;

  • благодаря низкоуровневой оптимизации TCP/IP улучшено использование портов связи, открытых между клиентом и сервером. Порты быстрее активизируются и эффективнее используются.

Преимущества для пользователей включают не только повышенную производительность, но и дополнительные функции, которые повышают удобство использования:

  • активное управление загрузкой и сценарии по запросу — эти усовершенствования настраивают приоритет ресурсов и JavaScript таким образом, чтобы в первую очередь загружался наиболее значимый для пользователей контент;

  • более насыщенное и интерактивное использование браузера благодаря плавному переходу между страницами с анимационными эффектами;

  • стратегия минимальной загрузки — когда пользователи просматривают контент SharePoint, загружаются и отправляются клиенту только изменения на странице.

Результаты тестирования WAN-подключения группой разработки

На следующих схемах подробно показано влияние повышения производительности WAN-подключения на одной из самых популярных страниц в SharePoint сайте группы. На схемах показаны сетевые трассировки сайта группы для SharePoint 2010 и SharePoint Server 2013 со следующими условиями сети:

  • задержка передачи — примерно 300 мс;

  • полоса пропускания между сервером и клиентами — 1 Мбит/с.

Эти условия включают более длительные задержки и меньшую полосу пропускания, чем характерно для WAN-подключений. При этом некоторые клиенты, имеющие очень удаленные сайты, попадают в этот диапазон (например, горнодобывающие, нефтегазовые и всемирные строительные компании). Полоса пропускания, равная 1 Мбит/с, меньше обычной скорости соединения мобильной связи.

На схеме ниже показано, что SharePoint Server 2013 эффективнее использует доступные порты связи.

На двух трассировках сети горизонтальные строки представляют открытые порты. Цветные блоки представляют проходящий по каналу контент, например изображения, JavaScript и HTML. В трассировке сети SharePoint 2010 белые области между цветными блоками представляют время простоя, в течение которого клиент или сервер ожидает выполнения какого-либо события, прежде чем перейти к следующему действию. В трассировке сети SharePoint Server 2013 сетевая магистраль заполнена почти на 100 %. Пока не завершена транзакция, выполняется обмен данными между клиентом и сервером. Время простоя между действиями очень мало или отсутствует. Эти улучшения стали возможны благодаря оптимизации, описанной ранее в этой статье (стратегия минимальной загрузки, активное управление загрузкой и сценарий по запросу).

На следующей схеме продемонстрировано улучшенное использование полосы пропускания. Синие графики в обеих сетевых трассировках показывают использование полосы пропускания. В SharePoint Server 2013 полоса пропускания используется эффективнее.

На следующих схемах сетевых трассировок показано, что контент, с которым взаимодействуют пользователи на странице (библиотека документов, подсказки, элементы навигации и др.) загружается в SharePoint Server 2013 на целую секунды быстрее, чем в SharePoint 2010. Это значительно ускоряет работу пользователей с сайтом.

Оптимизация глобальной сети в SharePoint Server 2013 (по сравнению с SharePoint 2010) обеспечивает следующие улучшения для этого сценария:

  • загружается на 65 % меньше байтов изображений благодаря оптимизированному использованию сжатия изображений;

  • загружается на 20 % больше байтов JavaScript, благодаря чему браузер работает лучше и быстрее;

  • всего загружается на 15 % меньше байтов.

Простое модульное тестирование WAN-подключения

Самый простой способ протестировать производительность WAN-подключения — попросить удаленного пользователя подключиться к сайту SharePoint и выполнить несколько действий. Например, можно создать собрание по сети, сообщить пользователю, какие действия необходимо выполнить, и подсчитать, сколько секунд выполняются действия. Кроме того, вы можете удаленно подключиться к компьютеру и выполнить задачи.

Например, на раннем этапе перехода на SharePoint Server 2013 корпорация Майкрософт работала совместно с Teck, чтобы оценить производительность WAN-подключения между двумя центрами данных одной горнодобывающей компании в Сантьяго (Чили) и Калгари (Канада). Махмуд Джаффер (Mahmood Jaffer), ИТ-специалист и архитектор SharePoint, создал удаленное подключение из своего офиса в Канаде к центру данных в Сантьяго. С компьютера в Сантьяго он подключился к серверу с SharePoint Server 2013, расположенному в центре данных в Калгари, и отправил несколько файлов. Он также подключился к серверу с SharePoint 2010 в Калгари и отправил файлы с такими же характеристиками. Результаты представлены в следующей таблице.

Модульное тестирование Teck: отправка файла из Сантьяго в Калгари (задержка — 140 мс) с использованием устройства Riverbed

Размер и тип файла SharePoint 2010 SharePoint 2013
1 МБ, PDF
5 секунд
<1 second
10 МБ, ZIP
25 с
12 с

Важная составляющая этого теста — использование устройства-ускорителя сети WAN между двумя точками. Для ускорения трафика Teck использует устройство Riverbed. Ускорители сети WAN ищут в пакетах данных шаблоны и могут отправлять только уникальные пакеты, замещая повторяющиеся пакеты контентом, сохраненным в кэше на другом конце. Так как было важно получить точные результаты, для каждого теста компания Teck использовала файлы с разным контентом, а не просто переименовывала файлы.

Чтобы повторить этот тест, группа технических писателей Microsoft SharePoint попросила коллег из офиса в Пекине подключиться к сайтам SharePoint в офисе в Редмонде. В этом сценарии два писателя многократно повторили тест в течение дня и получили ряд результатов. Во избежание возможных проблем с кэшированием каждый раз использовались файлы с различным контентом, хотя между двумя точками не использовалось устройство-ускоритель сети WAN. Результаты представлены в следующей таблице.

Модульный тест группы технических писателей корпорации Майкрософт отправка файла из Пекина в Редмонд (задержка 144 мс)

Размер и тип файла SharePoint 2010 SharePoint 2013
1 МБ, PDF
8–9 с
7–8 с
10 МБ, ZIP
53–140 с
49–63 с

Вот некоторые наблюдения, полученные при сравнения этих двух наборов результатов.

  • Многократное тестирование в течение дня или недели даст ряд результатов.

  • Диапазон результатов для SharePoint Server 2013 уже, чем диапазон результатов для SharePoint 2010. Результаты более предсказуемы для SharePoint.

  • Характеристики сетевой среды могут повлиять на результаты больше, чем задержка. В обоих тестах использовались соединения через сеть WAN с одинаковыми задержками. Скорость была меньше при соединении между Пекином и Редмондом. Характеристики сетевой среды включают шаблоны маршрутизации, перегрузки сети, потери пакетов и другие факторы. Некоторые географические регионы и международные телекоммуникационные компании менее оптимизированы для трафика WAN.

  • Проведя простое модульное тестирование, можно получить полезные данные. В этих двух случаях вряд ли удалось бы повторить реальную ситуацию путем ввода чисел, представляющих полосу пропускания и задержки, в симулятор сети WAN.

Вот рекомендации, которые помогут вам провести собственное простое модульное тестирование:

  • Используйте различные файлы с различным содержимым, чтобы избежать оптимизации устройств-ускорителей сети WAN при второй отправке.

  • Проводите несколько тестов в течение дня или недели, чтобы получить результаты для различных сетевых нагрузок.

  • Помните, что в SharePoint Server 2013 файлы могут отправляться медленнее, чем в SharePoint 2010, в связи с новыми функциями эффективного файлового ввода-вывода. Эффективный файловый ввод-вывод это метод хранения, при котором файл разбивается на части, которые хранятся и обновляются отдельно, но передаются в потоке одновременно, когда пользователь запрашивает файл. Поэтому первая отправка может выполняться медленнее. В дальнейшем файл будет загружаться и отправляться быстрее, так как будут обновляться только измененные фрагменты. При этом вы можете заметить, что SharePoint Server 2013 работает медленнее, когда будете тестировать версии параллельно или в близости с серверами. Результаты двух модульных тестов, описанных в этой статье, показывают, что оптимизация соединений через сеть WAN в SharePoint Server 2013 значительно превышает разницу во временных затратах, вызванных применением функции эффективного файлового ввода-вывода при соединениях с большими задержками.

Прежде чем приступать к какому-либо типу систематического нагрузочного тестирования в среде сети WAN, необходимо понять характер своей сети. Вы должны владеть данными о полосе пропускания, задержках, перегрузке сети, потере пакетов и типах устройств между пользователями и интерфейсным веб-сервером SharePoint. Эти данные не всегда легко получить. Но в этом вам помогут такие инструменты, как System Center Operations Manager.

Изучив свою сетевую среду, вы будете знать, нужно ли обращать особое внимание на определенные элементы, прежде чем приступать к тестированию WAN-подключения. Для первого тестирования сведите к минимуму перегрузку сети и потерю пакетов. Кроме того, удалите или отключите устройства для оптимизации сети. Таким образом полоса пропускания и задержки останутся двумя основными факторами, влияющими на работу конечных пользователей с точки зрения сети.

Средства тестирования

Разобравшись с ограничениями сети WAN, вы можете начать применять комбинации средств для тестирования эффективности WAN-подключения. Регламентированные средства, например Visual Studio 2012; с обновлением 1, предлагают возможности повторяемого модульного и нагрузочного тестирования. Нерегламентированные средства, такие как Microsoft Network Monitor (Netmon) с Visual Round Trip Analyzer, обеспечивают мониторинг, ориентированный на конечных пользователей. Полезными могут быть оба типа средств, так как они предоставляют различные подходы к тестированию WAN-подключения и сбору данных. Комбинированные результаты могут предоставить вам полную картину того, как влияют WAN-подключения на работу пользователей.

В следующей таблице приведены преимущества обоих средств.

Visual Studio 2012 с обновлением 1 Network Monitor с Visual Round Trip Analyzer
Возможности повторяемого модульного и нагрузочного тестирования
Сбор данных от серверов и агентов нагрузочного тестирования
Подключаемые модули для тестирования нагрузок SharePoint
Экспорт в Excel с возможностью сводки
Возможность реальной и смоделированной полосы пропускания и задержек
Наблюдение, ориентированное на конечных пользователей (получение реальных данных их работы)
Анализ сетевых пакетов и портов
Низкий барьер записи (свободная и легкая настройка)
Отражается реальная полоса пропускания, задержки, перегрузки, потери пакетов и оптимизация

Тестовые сценарии

Создайте тестовые сценарии, отражающие типы действий пользователей в рамках их работы. Распространенные сценарии:

  • просмотр сайта группы;

  • заполнение формы;

  • отправка документа;

  • загрузка документа;

  • просмотр документа на сервере Office Web Apps;

  • редактирование документа в Office Online Server;

  • запись в канале новостей;

  • добавление тега.

Цель — получить всесторонний набор модульных тестов, собирающих данные о действиях пользователей в среде SharePoint и обнаруживающих транзакции, которые могут быть чувствительны к задержкам.

Наконец, обязательно повторяйте тесты в различное время дня, чтобы определять различия в шаблонах использования сети. Например, шаблон использования сети и показатели, полученные в 09:00 утра в понедельник, могут значительно отличаться от полученных в 23:00 в пятницу. Кроме того, необходимо учитывать события, происходящие в различных географических регионах (например, стихийные бедствия или общерегиональные отключения электроснабжения), которые могут повлиять на маршрутизацию и показатели функционирования сети WAN. Всеохватывающий набор тестов, проводимых с различными интервалами, позволит вам составить представление о работе пользователей с сетью WAN при использовании SharePoint Server 2013 и покажет, чего следует ожидать в такой ситуации.

Пример тестирования сети WAN с использованием Visual Studio 2013

Пример тестового сценария см. на странице Пошаговое руководство по тестированию сети WAN с SharePoint 2013 при помощи Visual Studio 2012. В этом 3-мегабайтном наборе слайдов Visio продемонстрировано создание и загрузка веб-теста для тестирования сети WAN с использованием Visual Studio 2013.

Результаты тестового примера

Fabrikam это вымышленная большая всемирная производственная компания, которая участвовала в программе предварительного выпуска SharePoint Server 2013. Fabrikam использовала Visual Studio для создания сценария нагрузочного теста, состоящего из многих модульных тестов, а затем выполнила нагрузочный тест из различных географических местоположений.

В этом первом наборе результатов два пользователя в офисе Fabrikam в Шанхае, Китай, провели нагрузочное тестирование серверов с SharePoint Server 2013, расположенных центре данных в Техасе, США. Задержка составила около 190 мс. Тесты отправки, загрузки и Office Online Server проводились с использованием файла размером 1 МБ.

Fabrikam — производительность WAN-подключения между Шанхаем в Техасом при использовании набора функций

Результаты тестов свидетельствуют о высокой производительности, особенно для социальных задач.

Следующий набор результатов демонстрирует производительность при таком же нагрузочном тестировании с большим количеством географических местонахождений, в которых работают сотрудники Fabrikam. Серверы SharePoint расположены в Техасе, США.

Fabrikam — результаты по набору функций для различных расположений

Несмотря на различные уровни задержек, наблюдается высокая производительность для пользователей во всем мире. Результаты тестирования Fabrikam — пример систематического тестирования WAN-подключения, при котором используются нагрузочные тесты, состоящие из многих важны для компании задач SharePoint.

Fabrikam это пример международной компании, которая успешно использует модель центрального центра данных вместо развертывания SharePoint Server 2013 в нескольких регионах мира. Если вы планируете переход с модели центрального центра данных на несколько сайтов SharePoint в различных географических регионах, обязательно убедитесь в его необходимости с помощью WAN-подключения.

См. также

Понятия

Глобальные архитектуры для SharePoint 2013

«Снижаем скорость – сохраняем жизнь»: в Чувашской Республике стартовала Шестая Глобальная неделя безопасности дорожного движения

С 17 по 23 мая решением Организации Объединенных Наций во всем мире проводится Шестая Глобальная неделя безопасности дорожного движения «Снижаем скорость – сохраняем жизнь». Мероприятия в рамках Недели в странах-участницах ООН пройдут под единой концепцией «Дороги для жизни» («Streets for life»), направленной на привлечение внимания мировой общественности к уязвимому положению пешеходов как участников дорожного движения и принятие мер по повышению их безопасности.

Внимание аудитории будет акцентировано на прямой взаимосвязи между снижением скоростного режима и сокращением летальности в результате ДТП. По данным Всемирной организации здравоохранения, снижение средней скорости на 5% может привести к сокращению числа дорожных аварий со смертельным исходом на 30%.

Согласно международным исследованиям, для взрослого пешехода в случае наезда автомобиля, двигающегося со скоростью 50 км/ч, вероятность гибели составляет около 20%. Если же удар происходит при скорости 80 км/ч, риск летальности возрастает почти до 60%. Для детей и пожилых людей риски еще выше.

В Чувашии в поддержку основной идеи Недели будет проводиться целый ряд информационных, пропагандистских и правоприменительных мероприятий. Ориентированные на различные социальные и возрастные группы, они будут организованы в местах массового пребывания населения, социальных и культурных объектах, образовательных организациях, автотранспортных предприятиях с учетом санитарно-эпидемиологической обстановки в регионе.

В образовательных организациях состоятся специальные уроки, а в автотранспортных предприятиях — встречи, посвященные главной теме Глобальной недели.

Госавтоинспекция Чувашии призывает жителей республики, водителей и пешеходов поддержать мероприятия Шестой Глобальной недели безопасности дорожного движения. Каждый неравнодушный к проблемам дорожной безопасности житель республики имеет возможность продемонстрировать свою позицию, приняв непосредственное участие в профилактических мероприятиях и разместив на своих страницах в социальных сетях фото и видео по тематике Недели под общим хештегом #ДорогиДляЖизни (#StreetsForLife).

УГИБДД МВД по Чувашской Республике

Глобальное потепление связано с деятельностью человека и происходит с беспрецедентной скоростью   

Беспрецедентные изменения 

Изменение климата, вызванное деятельностью человека, уже сегодня приводит к многочисленным случаям экстремальной погоды во всех регионах планеты. Более того, по данным ученых, меняется вся климатическая система Земли, и эти изменения сказываются на состоянии атмосферы, океанов, ледовых покровов и поверхности Земли. Многие из этих изменений беспрецедентны, а некоторые тенденции – например, рост уровня океана – в ближайшие века или даже тысячелетие невозможно обратить вспять. 

 

Однако в силах человечества ограничить масштабы изменения климата, считают авторы доклада – 234 эксперта из 66 стран мира: существенно сократив выбросы в атмосферу вредных веществ, в том числе парниковых газов, можно в короткие сроки значительно улучшить качество воздуха и стабилизировать глобальную температуру. 

Сигнал тревоги для человечества 


 

Фото CIFOR/Н.Суджана

«Нулевые выбросы» означают, что объемы эмиссий углекислого газа не превышают его объемов, поглощаемых океанами и лесами.

По мнению Генерального секретаря ООН Антониу Гутерриша, доклад Рабочей группы не что иное, как сигнал тревоги для всего человечества. «Этот набат оглушителен, а представленные свидетельства неоспоримы», –  прокомментировал глава ООН выводы ученых. 

Этот набат оглушителен, а представленные свидетельства неоспоримы

Он напомнил, что международное сообщество согласилось удержать глобальное повышение температуры на уровне не более 1,5 градуса, однако уже в ближайшее время, если не принять срочных мер, этот порог будет перейден. «Мы должны действовать решительно, чтобы не допустить этого», – предупредил Гутерриш. 

Он отметил, что в преддверии конференции по климату, которая состоится в Глазго в ноябре, все страны, а особенно входящие в Группу двадцати, должны подтвердить свою приверженность борьбе с изменением климата, в том числе примкнуть к коалиции «нулевых выбросов». 

Время на исходе

Unsplash/Р.Десгагнес

Ледники в Исландии.

Как указывается в отчете, выбросы парниковых газов в результате деятельности человека были основной причиной потепления глобального климата примерно на 1,1 градуса по шкале Цельсия в период с 1850 по 1900 годы. Ожидается, что в ближайшие 20 лет этот уровень в среднем достигнет или превысит 1,5 градуса. 
 
«Этот отчет – трезвая оценка того, какой будет реальность в ближайшие десятилетия, – говорит сопредседатель рабочей группы экспертов Валери Массон-Дельмот. – Теперь мы имеем гораздо более четкую картину прошлого, настоящего и будущего климата Земли, что очень важно для понимания того, куда мы движемся, что мы еще можем сделать и как нам следует подготовиться к будущим изменениям».
 
Согласно прогнозам ученых, в ближайшие десятилетия климатические изменения будут нарастать во всех регионах планеты, в частности, будут увеличиваться периоды длительной жары и сокращаться холодные сезоны. При глобальном потеплении на два градуса по шкале Цельсия пострадает, прежде всего, сельское хозяйство и усилится нагрузка на системы здравоохранения. 

Последствия изменения климата 


 

Фото ООН/Д.Дикенсон

Для борьбы с изменением климата необходимо сократить вредные выбросы в атмосферу.

Но дело не только в повышении температуры. Изменение климата приводит к множеству непрогнозируемых последствий в самых разных сферах, в том числе:
 
● Изменение климата усиливает круговорот воды, что в одних регионах приводит к интенсивным осадкам и связанным с этим наводнениям, а в других – к экстремальным засухам.
 
● Изменение климата влияет на характер выпадения осадков. В высоких широтах вероятность выпадения осадков увеличивается, в то время как на территории большей части субтропиков происходит их уменьшение. 
 
● В прибрежных районах в XXI веке будет продолжаться тенденция подъема уровня моря, что, в свою очередь, будет способствовать более частым и сильным наводнениям в низинных районах и эрозии почвы. Экстремальные изменения уровня моря, которые раньше происходили один раз в 100 лет, будут происходить ежегодно ближе к концу нынешнего века.
 
● Дальнейшее потепление усилит таяние вечной мерзлоты, потерю снежного покрова и сокращения ледников в Арктике.
 
● Изменения в состоянии мирового океана вызовут более частые приливы теплых течений, что отразится на экосистеме океана и на положении людей, которые живут за счет рыбной ловли.
 
● Отдельные аспекты изменения климата могут отразиться на жителях городов, которые почувствуют потепление климата, а также столкнутся с наводнениями из-за сильных осадков и повышения уровня моря в прибрежных регионах.
 
«В процессе многолетнего изучения степени влияния человека на изменения климата Земли мы однозначно выяснили, и негативная роль человеческого воздействия не вызывает сомнений, – говорит Валери Массон-Дельмот. – Увеличение содержания углекислого газа в атмосфере является основной движущей силой изменения климата, и мы обязаны воспринимать этот фактор как данность».
 
 
 
 

ШЕСТАЯ ГЛОБАЛЬНАЯ НЕДЕЛЯ БЕЗОПАСНОСТИ ДОРОЖНОГО ДВИЖЕНИЯ ООН 2021 во всём мире пройдёт с 17 по 23 мая

13 мая 2021

Информация МО МВД России «Ирбитский»

Тема недели: создание улиц, безопасных для жизни. В этот период будет объявлен план мероприятий Второго десятилетия действий по БДД.

 

Уже в 2022 году мировые лидеры встретятся на совещании по безопасности дорожного движения, и только вместе мы сможем донести единое послание, требующее создание безопасных улиц для каждого.

 

Вместе с @dddgazeta и @stopgazeta присоединяйтесь к кампании #Дорога30, призывающей, чтобы ограничение скорости в 30 км/час вблизи жилых районов и образовательных организаций стало нормой для городов, посёлков и деревень по всему миру!

 

Сейчас самое время отреагировать на этот призыв к действию. Расскажите всем своим близким о необходимости обеспечения безопасности дорожного движения везде и для всех, уделяя приоритетное внимание низкоскоростным улицам во всех жилых районах и вблизи образовательных организаций.

 

5 шагов, которые помогут сделать жизнь лучше:

 

1. Распечатайте плакат Шестой глобальной недели безопасности дорожного движения (также его можно скачать на сайте www.dddgazeta.ru в разделе «Документы»).

 

2. Напишите, почему важно соблюдать скоростное ограничение 30 км/час в жилых районах и вблизи образовательных организаций.

 

3. Сфотографируйтесь с плакатом или запишите короткое видео. (В видео объясните, почему вы поддерживаете ограничение скорости 30 км/час.)

 

4. Загрузите фото и видео в соцсети с хэштегом #НеделяБДД, #ДорогиДляЖизни, #Love30, #ДобраяДорогаДетства.

 

5. Расскажите об акции как можно большему числу людей.

 

Важно: обеспечьте свою безопасность, когда делаете фото или снимаете видео. Соблюдайте ПДД. Убедитесь, что другие участники дорожного движения вас видят и ни в коем случае не подвергайте себя и других людей опасности!

 

ОГИБДД МО МВД России «Ирбитский»

 


Свежие публикации данной категории

Глобальная проверка. Как проверить скорость интернета — онлайн тест соединения на компьютере и телефоне, SpeedTest, Яндекс и другие измерители

Speed Test — Проверьте Скорость Интернета / Speed ТЕСТ

Здесь вы можете легко, быстро и бесплатно выполнить проверку скорости вашего соединения DSL. Нажмите ниже на «Начать Тест». Тест начинаеться, как правило, в течение нескольких секунд.

Для Тестирования Скорости DSL Обратите внимание на следующее: результат не всегда точен, проверка скорости всегда зависит от различных факторов. Поэтому измерение должно быть интерпретировано только как руководство.

Пожалуйста, оставьте другие интернет-приложения закрытыми во время измерения, в противном случае результат спидтеста будет неточными.

Во время тестирования скорости интернета, тестовый файл загружается в Вашем браузере. Примерно через 10 секунд мы проверяем какой объем данных был загружен. Со ссылкой на время загружаемых данных, примерная скорость DSL (интернета) может быть определена. Важно, что сервер, который содержит тестовый файл должен быть быстрым. Мы полагаемся на отдельном высокопроизводительном сервере, так что результат максимально точный.

Нажмите в нижнем поле на «Начать Тест», чтобы инициализировать спид тест (speedtest). Убедитесь, что никакие другие приложения не будут иметь доступ к Интернету во время испытаний скорости интернета.

Как начать тест скорости Интернет трафика:

Нажмите на кнопку «Начать Тест», в поле выше, чтобы начать тест скорости интернета. Тест затем начнётся и он обычно занимает несколько секунд для завершения. После завершения спидтеста, вам будет предоставлено возможность проверить снова на другом сервере, который ближе к вашему текущему местоположению. Что потребуется для использования теста скорости?:

Чтобы использовать сайт, все что вам нужно это современный веб-браузер поддерживающий HTML5. Поддерживаемые Браузеры: Chrome 44, Opera 31, Firefox 40, Edge, Safari 8.0, Edge 13, Safari 9.0, Chrome 42, Opera 29, Chrome 40, Opera 26, Chrome 36, Firefox 35,Firefox 37, Chrome 28, Firefox 28, Firefox 18, Safari 7.0, Opera 12.10, Internet Explorer 11, Safari 6.0, Internet Explorer 10, Safari 5.1, Internet Explorer 9, Internet Explorer 8. Вам не нужно устанавливать любое программное обеспечение, чтобы использовать сайт, и она работает полностью в вашем браузере на Windows, Mac OS X, Android и Linux. Небольшая разница 10-15% это нормально, потому что спид тест не может быть точным (в зависимости от загруженности сервера вы можете получить разные результаты cgblntcn). Если разница превышает 30%, то измерьте скорость чуть позже или попробуйте проверить на другом сервере (ссылка выше). Некоторые поставщики услуг Интернета предлагают свои собственные тесты скорости.

Мы не несем никакой ответственности за результаты Теста Скорости Интернета, так как точность теста зависит от многих факторов.

Тест скорости Интернета для вашего сайта.:

Добавьте тест скорости на вашем сайте.

DSL Speed Тест

DSL Speed Тест измеряет производительность передачи данных вашего собственного провайдера DSL. Оба загрузки и загрузка данных проверяется и по сравнению со значениями других проверок с этого провайдера DSL. Тест скорости DSL предоставляет важную информацию о том, соответствует ли качество вашего собственного поставщика к договору DSL. Она также может предоставить информацию о том, является ли ваша собственная сеть подвергается значительным колебаниям.

Как работает Тест Скорости DSL детально?

Speed Тест это программа доступна на веб-сервере. При запуске спид теста с помощью веб-браузера, веб-сервер сначала переносит один или несколько файлов в кэше браузера пользователя. Если несколько файлов используются, они разработаны с разным размером и с разной компрессией. При передачи данных, возможно, Первое измерение скорости загрузки. Впоследствии же данные передаются обратно на веб-сервер, так что эффективность загружаемых файлов может быть определена. Как правило, скорость передачи данных загрузки значительно хуже, чем у скачиваний.

Какие ограничения должны быть рассмотрены в результатах измерений?

Тем не менее, следует отметить, что результаты одного измерения не очень значимым. Параллельно с текущим измерением, в сети выполняются другие процессы, которые могут повлиять на скорость. Поэтому следует убедиться, что больше нет никаких передач данных в сети во время теста. В частности, только один компьютер в сети должен быть активным. Только один экземпляр браузера должен быть запущен и другие виды деятельности следует избегать на данном компьютере. Необходимо также обеспечить, чтобы ни антивирус, ни другая программа не обновляются на момент тестирования. Когда все эти вещи принимаются во внимание все еще нужно выполнить несколько измерений в разное время для того, чтобы обнаружить универсальное значение для результатов испытания скорости DSL. Если вы провели несколько измерений, то можно легко определить среднее значение измерений в качестве реальной скорости передачи для подключения DSL.

DSL и Wi-Fi(WLAN)

Тест скорости имеет большое колебание, если вы используете Wi-Fi для этого. Поскольку внутренняя WLAN может зависеть от различных факторов, в своих возможностях производительности. Часто расположеные в городах, многие беспроводные сети в конфликте друг с другом, особенно, когда они должны работать на той же частоте. Если хотите иметь хорошие и значимые результаты для своего теста скорости DSL, вы должны попытаться подключиться по проводной сети к Интернету. При необходимости, Вы будете иметь успех, даже если вы можете убедиться, что ваша собственная беспроводная сеть обладает частотой, которая отличается от всех других беспроводных сетей в этом районе.

Интернетометр Яндекс – это полезный онлайн-сервис, позволяющий пользователю самостоятельно измерить скорость Интернета, определить свой IP-адрес, а также ряд наиболее важных характеристик веб-соединения.

Иногда, подключившись к тому или иному провайдеру и испробовав Интернет-соединение, возникают определенные сомнения. Они касаются соответствия заявленной в договоре скорости загрузки или передачи данных и ее реального значения.

Как правило, в описании тарифного плана указаны завышенные скоростные показатели. Это является своего рода продуманным рекламным ходом поставщика подобных услуг.

Для установления факта обмана необходимо выполнить проверку соединения, а поможет в этом специальный Интернетометр-сервис.

Интернетометр Яндекс — как измерить скорость

Подготовка к тестированию.

Прежде, чем приступить к точному тестированию, необходимо провести ряд мероприятий:

  • закрыть все ранее запущенные программы и оставить только браузер с одной активной вкладкой самого сервиса;
  • дождаться завершения всех загрузок в браузере или же выполнить их принудительную остановку;
  • убедиться в том, что в момент проверки не запущено никаких обновлений;
  • отключить брандмауэр Windows.

Тестирование.

На стартовой странице Интернетометра, которая является единственной, сразу же отображается:

  • уникальный адрес компьютера, с которого был выполнен вход на сервис;
  • географический регион проживания пользователя;
  • сводная информация о веб-обозревателе;
  • расширительная способность экрана компьютера.

Опция «Показать подробную информацию» позволяет просмотреть характеристики операционной системы, данные о самом клиенте, наличие JavaScript и Flash, куки Яндекса и прочие информационные сведения о системе.

Верхний правый угол страницы сервиса используется для размещения рекламы браузера Яндекс Интернет.

Другие особенности Интернетометра

Запуск Яндекс Интернетометра сопровождается работой программы «колдунщик». Он-то и предоставляет данные об IP-адресе пользователя.

На введенные запросы, касающиеся определения IP, он указывает не только сам адрес, но и позволяет просмотреть более детальную информацию о типе и других характеристиках соединения между выбранным провайдером и Яндексом.

Сервис Интернетометр служит также и для определения показаний быстродействия используемого соединения. Для этого существует специальная кнопка. Необходимо просто нажать на нее и подождать несколько секунд, после чего Интернетометр автоматически выполнит проверку скорости закачки и передачи данных в сеть.

Время ожидания зависит от качества соединения. Чересчур медленный Интернет может вызвать зависание сервиса или приведет к выдаче на экран компьютера ошибки о невозможности завершить тестирование.

Процесс измерения скоростных характеристик веб-соединения сопровождается обращением к специальным серверам, располагающимся в Москве. Яндекс выполняет многократную загрузку и передачу тестового файла, а затем вычисляет среднее значение его скорости.

Скорость Интернета – величина непостоянная и может изменяться несколько тысяч раз в сутки. Для получения более достоверной информации рекомендуется выполнить многократное тестирование, а из выданных результатов выбрать некую среднюю величину.

По отзывам многих пользователей, на быстроту Интернета влияют и находящиеся на компьютере программы, которые работают с ресурсами Сети. К наиболее затратным из них относятся утилиты, предназначенные для закачки больших объемов данных. Среди них следует выделить торренты, Download Master и другие.

Помимо этого, результаты проверки могут разниться между собой из-за перегруженности серверов. Стопроцентную точность измерения скорости в этом случае никто не гарантирует. Однако Интернетометр Яндекс работает все-таки более менее прилично, без каких-либо сбоев и сильного искажения реальных показателей определяемой величины.

При использовании интернета от провайдера у пользователей возникают сомнения относительно скорости передачи данных. Не всегда будет понятно полное соответствие реальных данных с указанными в заключенном договоре. Чаще представители умышленно завышают данные, чтобы привлечь на свою сторону клиентов. Но факт обмана быстро определяется самостоятельно. Позволит Яндекс интернетометр измерить скорость интернета и уличить поставщика услуг в фальшивости.

Начало тестирования

Существуют некоторые подготовительные мероприятия, которые проводятся до проверки скорости интернет-соединения на компьютере или другом устройстве.

  1. Открываться должен только один веб-браузер с вкладкой проверки скорости. Остальные программы, использующие интернет в работе, должны отключаться. Это будет создавать проблемы, и предоставлять неверные итоговые результаты.
  2. При наличии загрузок в браузере их стоит остановить или дождаться момента окончания. Существует вариант принудительной остановки загрузки, который также может использоваться при подготовке к проверке.
  3. Не должно включатся обновлений программ или программного обеспечения на устройстве. Это касается, в том числе и антивирусов, постоянно обновляющих данные через собственный сервер.
  4. Происходит отключение брандмауэра Windows.

Когда все это выполнено, можно приступать к следующему шагу, используя сервис для измерения скорости интернета от выбранного поставщика услуг.

Само измерение скорости

Стартовая страница интернетометра отображает уникальный адрес для устройства, с которого производился доступ к сервису, а также регион проживания клиента с точки зрения географического положения. Кроме этого на главной странице имеется информация по веб-обозревателю (только сводные данные), сведения по экрану компьютера с точки зрения расширительной способности.

На главной странице будет клавиша «Показать подробную информацию». С ее помощью просматривается информация по операционной системе устройства, наличию Flash и JavaScript, куков Яндекса, а также остальное, носящее существенное значение. В правом углу сверху отображается реклама браузера Яндекс Интернет.


При запуске Яндекс интернетометра осуществляется работа программы «колдунщик». С его помощью получается информация по IP-адресу ноутбука или компьютера. Кроме самого адреса появляется и вся остальная информация, как например качество соединения между Яндекс и используемым в работе провайдером.

Функционал сервиса

Рассматриваемый сервис позволяет определить быстродействие интернет-соединения. Здесь используется специальная кнопка, отображенной в виде прямоугольника жёлтого цвета. После ее нажатия и выжидания нескольких секунд работа системы начнется в автоматическом режиме. Интернетометр установит скорость передачи информации по сети, а также ее получения пользователем. Все будет полностью зависеть от качества соединения.

Если работа интернета очень слабая и медленная, сервис вообще может зависнуть и не предоставить конечному пользователю информации. На экране компьютера отобразиться лишь ошибка, что тестирование не может завершиться удачно.

При измерении скорости все характеристики обращаются к специальному сервису, расположенному в российской столице. Яндекс производит неоднократную передачу тестируемого файла, а также его загрузку на сервер. Средние показатели по скорости будут продемонстрированы пользователю по завершению тестирования.

Полученный результат может сохраняться до определенного момента, используя серверы Яндекса. Он отображается в виде специальных изображений, баннера. В последующем их можно использовать для вставки в собственный блог, на сайт, а также опубликовать на форум или другом веб-ресурсе. Достаточно будет получить специальный код для вставки, без которого нельзя будет показать результат третьим лицам.


Проблемы проверки

Интернет-соединение не может гарантировать потребителю постоянную скорость даже в течение суток. Она постоянно изменяется и это зависит от определенных факторов. Достоверные данные по скоростным характеристикам будут получены после того, как тестирование произойдет несколько раз. Полученные результаты должны расцениваться не в отдельности, а в среднем показателе, что можно высчитать самостоятельно.

Prostoweb решил узнать секреты измерения и глобальной проверки скорости интернета, которую предлагает ваш интернет-провайдер, с помощью специальных программ и сервисов тестирования: Speedtest или Спидтест, 2ip.ru, Realspeed. Какая у меня скорость интернета? — ведь этот вопрос волнует многих интернет-пользователей. Изучаем спид тест скорости интернета вместе!

В чем измеряется скорость интернета

Потому в действительности «скорость или замер скорости интернета» это не что иное, как скорость передачи данных в сети, которая зависит от многих факторов.

Эта скорость измеряется в физических единицах, как отношения времени передачи к объёму переданной информации. Многие слышали о таких показателях, как Кбит/сек, Мбит/сек, Гигабит/сек, они, подобно скорости автомобиля, показывают насколько быстро к нам «доедет» нужный файл из сети или веб-страничка.

Байт — это единица хранения и обработки цифровой информации.

  • 1 Байт = 8 битам. Именно к байту приводятся все большие объёмы информации, исчисляемые в компьютерных технологиях.
  • 1 килобайт (Кбайт) = 1024 байт.
  • 1 мегабайт (Мбайт) = 1024 Кбайт. Её применяют для измерения объёмов носителей информации.
  • 1 гигабайт (Гбайт) = 1024 Мбайт.

Скорость передачи данных (скорость соединения) измеряется в килобит в секунду (Кбит/сек). Мегабит в секунду (Мбит/сек.) = 1024 Кбит/сек.

Начинающие пользователи интернета часто путают килобиты с килобайтами. Потому рассмотрим пример. Представим что, в нашем тарифном плане скорость интернета составляет 0,5 Мегабит/с или 512 Кбит (Кб) в секунду. Если перевести скорость в килобайты, то получим 512 Кбит/8 = 64 Кбайт/с. Именно такую максимальную скорость следует ожидать при отображении скорости закачки в download-менеджерах или торрент клиентах.

В реальности скорость всегда будет несколько ниже, чем заявлено в тарифном плане вашего провайдера. Если вам понадобиться перевести одни единицы измерения скорости соединения в другие, воспользуйтесь онлайн-калькулятором, которые поможет вам в этом.

Для наглядности показателей скорости соединения, представим типичную веб-страницу, которая занимает 100 килобайт, песню — в среднем 3072 килобайта (3 мегабайта), фильм — 1572864 килобайт (1,5 гигабайта). Составим таблицу зависимости скорости скачивания от скорости интернета.

Скорость скачивания

56 кбит/с

256 кбит/с

1 Мбит/с

16 Мбит/с

100 Мбит/с

Web-страница

Песня

Фильм

Как тестировать скорость интернета

В большинстве случаев за скорость доступа в интернет нужно платить. И чем выше она, тем дороже нам это обходиться. Основное, что должно беспокоить каждого пользователя —— действительно ли мы получаем то за что платим. Для проверки и контроля скорости интернета существует несколько групп программных продуктов.

Онлайн-тесты

Это сайты, на которых размещены скрипты, показывающие вашу скорость относительно какого-либо сайта. Следует отметить, показания этих сайтов дают погрешность. Даже при двух последовательно проведённых тестах вы можете получить результаты, отличающиеся на 20-30 %. Для повышения точности тестов, необходимо выключить все программы, потребляющие траффик. А также выбрать тестер, наиболее близко расположенный к вам географически. Полезно провести ряд замеров в разное время суток, учитывая, что тестовые сервера могут быть загружены в определенное время сток.

Наиболее известные бесплатные сайты для тестирования скорости интернета:

  • http://speedtest.net/ — один из самых известных сервисов для тестировании скорости интернет-соединения. Для начала теста жмем «Begin Test» и получаем скорость скачивание и скорость отдачи файлов.
  • http://2ip.ru/speed/ — хостер, который предоставляет огромное количество тестов и исчерпывающую информацию о вашем подключении.
  • http://www.speedtest.com.ua/speedtest-net.htm — упрощенный вариант speedtest.net.
  • http://www.speedtest.com.ua/ — также простой тест скорости на украинском домене. Нажать кнопочку «Начать тест».
  • http://realspeed.co.kz/ — ещё один русскоязычный тестер.
  • http://www.numion.com/YourSpeed/ — этот тестер может показать сводную статистику за 25 замеров и также позволяет проверять скорости относительно серверов в разных странах мира.
Программы для определения и тестирования скорости интернета, требующие установку на ПК

Таких программ очень мало, потому что протестировать скорость загрузки интернета лучше между вашим компьютером и удаленным сервером, которыми и являются выше описанные сайты.

Для тех, кто не просто «серфит» сайты, а привязан к сети работой или играми, особенно актуальна скорость Интернет-соединения. Низкая скорость подключения может привести, например, к неправильному обновлению графиков на биржах ценных бумаг или провисаниям в онлайн-играх. Как же проверить скорость подключения? Рассмотрим несколько способов.

Проверка скорости интернета через командную строку

Проверить скорость Интернет-соединения можно без использования каких-либо программ либо сервисов, используя стандартные операционной системы Windows. Для нижеописанных манипуляций может потребоваться некоторые базисные знания по системному софту, но наша инструкция позволит вам более просто и быстро разобраться во всем.

Для этого необходимо проделать следующие действия:


После этого на экране будет виден процесс отправки пакетов данных с размером 32 байта. Главный показатель, на который следует обращать внимание, – это время передачи. Нормальным считается период до 100-150 миллисекунд.

Стоит помнить, что скорость передачи данных на конкретный сервер зависит еще и от качества работы самого ресурса. То есть, при обращении к различным сайтам скорость и время передачи могут меняться.


Как проверить скорость подключения через специальные сервисы?

Для проверки скорости работы Интернета на вашем компьютере можно использовать специальные онлайн-сервисы. Это наиболее доступный и простой метод, который под силу даже неопытным пользователям. Существует множество проверочных ресурсов, но мы рассмотрим 2 наиболее популярных и, как показывает опыт, наиболее точных.

Все нижеописанные ресурсы могут использоваться как для проверки скорости на ноутбуках, так и на стационарных ПК. Также для них не важно, каким способом осуществлено подключение – через кабель или через Wi-Fi.

speedtest.net

Пожалуй, этот ресурс является наиболее распространенным среди пользователей. Он имеет понятный графический интерфейс, а сама процедура проверки сопровождается приятной анимацией. Пользоваться сервисом достаточно просто:


Наглядно инструкция к онлайн сервису приводится в следующем видео:

Важно отметить, что в тарифах провайдеров всегда указывается скорость получения данных, а не их отдачи. Второй показатель, как правило, всегда ниже первого, но это не столь критично и не играет роли для вас, как для пользователя.

2ip.ru

Этот сайт является многофункциональным и дает доступ к различным сервисам, которые тем или иным образом касаются Интернета. Среди них есть и тестирование скорости соединения. Чтобы открыть тест необходимо перейти на вкладку «Тесты» и найти в перечне «Скорость интернет соединения»:


На данном сайте также подразумевается возможность выбора сервера, но если его не указывать, система сама подберет для вас наиболее оптимальный, по ее мнению, вариант. Для начала теста необходимо нажать кнопку «Тестировать», расположенную в нижней части активного окна:


В среднем проверка занимает несколько минут, а результат выводится в следующей форме:


Таким образом, в считанные минуты вы сможете узнать скорость своего интернет соединения без использования каких-либо сложных программ или манипуляций.

Помните, что при подключении через Wi-Fi показатель скорости соединения будет несколько ниже, чем при прямом кабельном подключении. Это обусловлено ограничениями самого оборудования.

Проверка скорости интернета при помощи Торрент

Существует еще один способ проверить скорость работы вашего Интернета. Для этого вам потребуется скачать любой торрент-клиент, если его нет на вашем компьютере. После чего в списке трекеров необходимо найти какой-либо файл, раздача которого осуществляется более чем 1000 пользователями, а количество скачивающих наиболее минимально. Именно такой файл и необходимо поставить на загрузку.

После старта скачивания должно пройти где-то 2-5 минут, чтобы скорость дошла до своего пика. Именно этот показатель и будет являться показателем скорости скачивания, то есть, получения пакетных данных. Обычно он приравнивается к тому, который указывается провайдерами.


Стоит отметить, что на торрентах в качестве основных единиц измерения используются килобайты и мегабайты. Для перевода данных в килобиты и мегабиты, которые используются провайдерами, необходимо умножить их на 8. То есть, при скорости скачивания в 1 мегабайт/сек, скорость интернета будет составлять 8 мегабит/сек.

Интернет давно стал настоящей необходимостью для многих пользователей и его скорость играет далеко не самую последнюю роль, поэтому важно следить за ее стабильностью. Вышеописанные способы позволят вам просто узнать скорость вашего соединения, и в случае возникновения каких-либо проблем быстро приступить к их устранению.

Как выходцу из России построить карьеру в глобальной корпорации

Профессиональный и личностный рост
Маргарита Кошман
Graeme Worsfold / Unsplash

Глобальные компании массово присутствуют в России уже три десятка лет, и этого времени, казалось бы, достаточно для того, чтобы перспективные российские сотрудники могли сделать хороший старт здесь и успеть вырасти на международных просторах. Но пока выходцев из России довольно мало в штаб-квартирах международных компаний, а на посту CEO таких компаний их и вовсе нет. Почему же?

Мы в Spencer Stuart Russia решили найти ответ на этот вопрос, обратившись к тем, кто все-таки смог построить карьеру за рубежом. Мы провели сложное и кропотливое исследование 155 крупнейших международных компаний, в основном из индустрий с более высокой «карьерной мобильностью» (отрасли потребительских товаров и ритейла, технологической, медиа и телекоммуникационной, фармацевтической отраслей). Через работу с нашей базой данных, публичным пространством, нашей сетью знакомств и прямые запросы в целевые компании мы искали «чемпионов» — топ-менеджеров, начавших карьеру в России и доросших до уровня не ниже «глобальный СЕО-3». Мы знали, что ищем крупицы золота в достаточно бедной породе. Так и получилось: пальцев хватит, чтобы пересчитать таких людей. Мы поговорили с каждым, комбинируя структурированное интервью и открытую беседу о том, что помогало и что мешало строить глобальную карьеру.

Уверены, что результаты этого исследования будут интересны как менеджерам, которые строят международную карьеру сейчас, так и компаниям, которые осознали необходимость привлекать людей с «развивающихся рынков» к работе в глобальных штаб-квартирах.

Первая сложная задача на пути глобальной карьеры — подняться с уровня страны на следующую ступень

На индивидуальном уровне образовательный, социальный и экономический контекст нашей страны повлиял на менталитет и набор ключевых навыков тех, кто начал свою карьеру здесь. Некоторые особенности (например, сильный фокус на результат и высокий образовательный уровень) помогали и помогают локальным менеджерам вырасти до уровня управляющих директоров по стране. А вот дальнейший (международный) рост часто блокируется из-за действия факторов, о которых идет речь ниже.

Вот ряд важных инсайтов от тех, кому удалось построить карьеру на международном уровне.

1. Нужно как можно раньше замечать сигналы о том, что вероятность карьерного роста такого человека, как вы, в вашей компании достаточно высока. Например, сигналы, что карьеру в компании делают люди не одного и того же образца (допустим, все люди в штаб-квартире — это немцы/итальянцы/французы примерно одного возраста).

Несколько наших респондентов на собственном примере поняли, что только смена компании даст толчок их дальнейшей карьере. Совет от них: если вы чувствуете себя явным аутсайдером — меняйте компанию. Так вы сможете получить лучший возврат на инвестицию вашего таланта в другом месте. Исключение для этого совета — случаи, когда попытка доказать свою ценность и стать первым «другим» топ-менеджером в этой конкретной компании становится вашей большой личной целью.

2. Крайне важно для построения глобальной карьеры наличие карьерных спонсоров. Следует иметь в виду, что у россиян есть ментальные блоки, работающие против концепции спонсорства в целом. Например, принято считать, что неприлично и даже стыдно просить о помощи в карьере, а успешному человеку достаточно показывать прекрасные результаты. Для начала нужно снять такой блок, если он обнаружится.

Есть несколько секретных ингредиентов, которые делают концепцию карьерных спонсоров мощным инструментом:

  • Волшебное число — нужно иметь, как минимум, двух карьерных спонсоров в каждый момент времени. Иначе возможности для роста становятся неустойчивыми из-за перемещений или изменения отношений с тем, кого вы считаете своим спонсором.

  • Карьерные спонсоры должны находиться в корпоративной иерархии на уровень выше того уровня, на котором вы хотите оказаться. Этот урок выучили почти все наши герои. До этого они полагали, что их начальник и есть их карьерный спонсор (но очень часто это совсем не так!) и теряли время, за которое можно было сделать еще шаг-другой наверх.

  • Ваши спонсоры должны быть влиятельными в организации и лично заинтересованы в развитии талантов.

  • Важно отнестись к поиску карьерных спонсоров очень серьезно: не ждать, а проактивно идентифицировать потенциальных спонсоров, собрать информацию об их интересах и целях и не бояться обратиться к ним напрямую.

  • Нужно открыто говорить о своих карьерных амбициях: чтобы было понятно, чему именно помогать. Но при этом важно избежать опасности прослыть карьеристом. Если открыться спонсору с человеческой стороны, а также говорить о своих недостатках и провалах в нужном для роста опыте, это только увеличит шансы на спонсорство.

  • Когда контакт установлен, нужно общаться со своими спонсорами дисциплинированно и структурированно и найти правильную частоту и глубину коммуникаций с каждым из них.

  • Нужен свободный английский, а в идеале еще какой-то язык (испанский, итальянский — в зависимости от текущей или целевой компании и географии). Это существенно облегчит задачу интеграции в глобальной компании. Например, Нигяр Махмудова (сейчаc Executive VP, Growth&Innovation в Danone) и Леонид Судаков (президент в Kinship) говорят по-испански.

И еще несколько советов, которые помогут стать заметным и выстроить репутацию на высоком уровне.

1. Нужно работать на одном из влиятельных рынков (одном из крупнейших или быстрорастущих). Перемещайтесь туда с незначимых рынков.

2. Необходимо активно вовлекаться в глобальные инициативы, браться на mission impossible проекты, демонстрировать интерес к делам компании за пределами своего рынка. Почти все наши «чемпионы» называли сложные проекты, которые показали и их способности, и умение работать за пределами текущего контекста, и мотивацию на глобальные задачи.

3. Следует использовать визиты региональных и глобальных боссов, чтобы повысить свою личную заметность. Проводите с гостями время не только в формальных презентациях о достижении планов, создавайте запоминающиеся впечатления о вас и времени, проведенном с вами.

4. Высказывайтесь! Навыки публичных коммуникаций имеют большое значение для глобальной карьеры, инвестируйте в их развитие. Когда вы присутствуете при каких-то дискуссиях и на встречах, не бойтесь высказать свое мнение или изложить идею.

5. Инвестируйте в свой внешний бренд, участвуя в индустриальных форумах и используя релевантные возможности нетворкинга высокого качества.

Когда вы продвинулись на позицию выше страны, следующая задача — стать на ней успешным

Велик риск, что глобальная карьера прервется, если при переходе на новую международную роль менеджер не знает и/или не работает со следующими движущими силами карьеры.

Сильная способность адаптироваться крайне критична, и у нее есть ряд сторон:

  • Важно пройти мультикультурный тренинг заранее и поработать с коучем по культуре той географии, в которой вам предстоит делать карьеру. Позаботьтесь также о коммуникационной адаптации не только в части словаря, но и тональности. Топ-менеджер, строящий карьеру в крупном британском ритейлере, призналась нам: ей пришлось пройти через серьезную эмоциональную настройку и тренинг, когда она поняла, что ее лучшие намерения воспринимались совсем не как позитивные (все дело было в тональности и нюансах построения фраз).

  • По прибытии сначала сфокусируйтесь на выстраивании отношений, а не на том, чтобы дать быстрый результат. Делайте это умно. Например, используя такую технику, как мэппинг стейкхолдеров: идентифицируйте тех, к кому прислушивается СЕО, правление и совет директоров и затем стройте отношения с этими людьми с целью сделать из них ваших сторонников (или, как минимум, нейтрализовать их).

  • Развивайте организационную чувствительность — способность считывать корпоративные традиции, нормы, неформальные структуры.

  • Сделайте адаптацию семьи при переезде на место новой роли важным приоритетом (особенно, если ваш новый офис находится не в Париже или Чикаго, а на периферии). Это важно для эффективной работы позже, когда ожидания по результативности неизбежно повысятся. Как сказал нам один топ-менеджер, он смог полностью сосредоточиться на новой роли в Америке только тогда, когда основные вопросы жизнедеятельности его семьи были решены.

  • К моменту продвижения за рамки привычного окружения очень важно достичь высокого уровня самоосознания. Без этого будет сложно найти тонкий баланс между адаптацией и сохранением своей уникальности. Есть риск потерять свою аутентичность. Если, к примеру, вам свойственно критично относиться к текущему положению дел, нужно выбирать те роли и проекты, где это качество органично, и научиться бросать вызов статус-кво в компании приемлемым для нее способом.

  • Функциональная экспертиза становится все менее и менее решающей на этом уровне. Стратегическая проницательность, умение влиять, сотрудничать и вести за собой очень разных людей — наличие этих навыков определяет, справится ли человек с новой ролью.

  • Перевыполнение плана — это как стартовая ракетная установка для рывка на следующий уровень. Но вот что нужно понимать: менеджеры, которые хотят расти глобально, должны постоянно показывать существенно большую эффективность, чем их коллеги. Как сказала одна из наших респондентов, нужно быть вдвойне эффективнее «коренных жителей корпорации», чтобы сохранять ту же скорость карьеры.

  • Продолжайте работать над тем, чтобы у вас было минимум два правильных карьерных спонсора на каждом этапе карьеры.

NB! Всегда выигрышно иметь спонсором члена правления или совета директоров. Все участники опроса, которые дошли до максимального на сегодня для выходцев из России уровня «глобальный СЕО-1», имели такого спонсора.

  • Ваши сторонники среди коллег часто могут стать той гирькой, которая способна склонить весы карьеры в ту или иную сторону, а топ-менеджеры из России как раз чаще всего не умеют управлять отношениями с коллегами (их умения обычно концентрируются на вертикали власти). Критично важно инвестировать в отношения с коллегами и стремиться к тому, чтобы они признали вас «своим человеком».

  • Будьте приятными для других. Эмпатия — не самая сильная сторона ориентированных на результат успешных русских. Но искреннее внимание и попытки помочь другим, не фокусируясь только на своих результатах, открывает множество дверей. Часто навыки активного слушания «западают» и требуют осознанного развития.

  • Публично признавайте успехи других. Они оценят, запомнят и скорее станут вашими сторонниками.

  • Откройтесь со своей человеческой стороны (дети, хобби, ваши личные истории — расскажите о них) . Но помните, что важно уметь делать это тонко и сохранять свою аутентичность.

  • Для того чтобы вас поддерживали, нужно доверие — не только тому, что вы дадите мощный результат, а и тому, как вы это сделаете. Нужно стать понятным для других. Не зря Леонид Судаков, принявший участие в нашем опросе, использовал два понятия: trust и credibility. Второе слово — это как раз о понимании другими вашей повестки, уверенности в отсутствии скрытых мотивов.

  • Не однажды мы слышали: на стадии выбора, кого из претендентов промотировать дальше по карьерной вертикали, текущие результаты имеют меньшее значение, чем желание работать с этим человеком.

  • Помните о скромности. Русские могут быть чересчур уверенными (погранично с высокомерием) и гордыми за то, что они сделали (в России или еще где-то), в то время как в каждой новой роли в глобальной карьере нужно заново доказывать свою успешность.

И напоследок

Наше исследование показало наличие с обеих сторон (со стороны работодателя и со стороны менеджеров, пытающихся сделать карьеру) ряда ментальных блоков и лидерских профилей, которые могут разрушить глобальные карьерные амбиции выходцев из России.

На стороне работодателей к ним относятся:

1. Следующие профили менеджеров в командах штаб-квартир, которые могут блокировать движение к разнообразию:

a. «Корпоративные динозавры», проработавшие свыше 20 лет в компании — они знают все и всех, и способны создавать такие феномены, как групповое мышление и предвзятость в решениях, часто в отношении непохожих на них людей;

b. Люди c очень похожей идентичностью (например, одной национальности, возраста, образовательного уровня).

2. Негативные стереотипы о русских — «агрессивные, не готовы сотрудничать, слишком прямолинейные», на что накладывается политическая токсичность. Эти стереотипы могут иметь разную степень интенсивности, но в любом случае нужно уметь относиться к ним не в эмоциональном, а рациональном формате.

На индивидуальном уровне:

a. Базовым лидерским стилем российских менеджеров является стиль «Командуй и Контролируй», в то время как для сложных региональных позиций нужен стиль «Влияние и Сотрудничество».

b. Русские очень сильно мотивированы на результат и не особенно мотивированы заботой о других или обществе. Такая специфика мотивации мешает развивать новые навыки, необходимые для глобальной карьеры.

c. Ментальный блок против политики в целом ведет и к отрицательному отношению к корпоративной политике.

d. Частью этого ментального блока является предубеждение против карьерного спонсорства, которое ассоциируется с непорядочным, нечестным поведением (блатом).

e. Наблюдается страх попросить важного человека в компании стать ментором, так как просьба о помощи часто ассоциируется со слабостью.

Эти блоки можно преодолеть с помощью специальных программ развития, изменения культуры и индивидуальной поддержкой карьеры.

Итоги нашего исследования позволяют отметить несоответствие между важностью развивающихся рынков (а они во многих случаях считаются ключевыми двигателями роста для многих глобальных компаний) и нулевой или мизерной представленностью в штаб-квартирах лидеров с этих рынков. Но если изменить корпоративные программы развития талантов и программы поддержки нанятых извне и выросших внутри организации менеджеров с учетом находок нашего исследования, вероятность успешности глобальных карьер таких людей существенно возрастет.

Об авторе. Маргарита Кошман — партнер российского офиса компании Spencer Stuart.

Взгляд мировых лидеров на достижение новой скорости и маневренности

По запросу, по требованию |
1 час
Темы обсуждений:
  • Повышайте продажи с помощью единой коммерческой команды, специально созданной для обслуживания клиентов
  • Получите 4 урока для стимулирования роста с помощью цифровой экосистемы
  • Будьте готовы к угрозам 21 века с динамическим управлением рисками

Почти 90% членов совета директоров заявляют, что они хотят более тесного межфункционального сотрудничества для восстановления после пандемии и обеспечения нового роста.Между тем, генеральные директора чаще всего называют скорость и гибкость качествами, которыми они восхищаются в компаниях, которые хорошо справились с кризисом. В передовой практике, хорошо подходящей для данного момента, появляются два общих течения: совместное использование и да, уступка — контроль, деньги, данные — ведет к скорости, если все сделано правильно; а хорошие перемены — это еще больше перемен, поэтому новые механизмы должны учитывать истощение. Этот бесплатный веб-семинар объединяет группу экспертов Gartner, которые расскажут о компаниях по всему миру, которые задают темп реорганизации для повышения скорости и гибкости, включая переосмысление традиционных межфункциональных отношений, изменение отношения бизнес-подразделений к бюджетам и создание совместных данных. платформы.

Вернитесь на эту веб-страницу, чтобы посмотреть веб-семинар. Свяжитесь с нами по [email protected] с вопросами о просмотре.

Показать больше Показывай меньше
Хозяин

Брент Адамсон,
Заслуженный вице-президент, консультант

Мегна Джоши,
Директор отдела исследований

Малькольм Мюррей,
Управляющий вице-президент

Веры Вакиль,
Директор по исследованиям

Мировой рынок скоростных сумок 2021 Размер, доля, анализ, спрос, драйвер роста и сегменты отрасли к 2027 году

Отдел новостей MarketWatch не участвовал в создании этого контента.

24 октября 2021 г. (Лента новостей CDN через Comtex) — Глобальный рынок скоростных сумок до 2021 года по производителям, регионам, типу и применению, прогноз до 2027 года. , представленное MarketsandResearch.biz. рассматривает рыночную структуру рынка посредством анализа его различных подсегментов. В отчете размер отрасли оценивается на основе стоимости и объема. Он исследует быстрорастущие сегменты, включая тип продукта, приложение и конечных пользователей, с учетом их CAGR, доли и размера.Отдельные темпы роста, перспективы и их отношение к общему мировому рынку скоростных сумок подвергаются дальнейшей оценке.

В отчете содержится конкретная информация о важных факторах, влияющих на рост рынка, то есть о потенциале роста, перспективах, драйверах, рыночных препятствиях и рисках. Текущее развитие рынка и будущие возможности оцениваются на период с 2021 по 2027 год в следующей части исследования. В исследовании изучается отображение ключевых продуктов, а также географическое присутствие и сегменты, подсегменты мирового рынка скоростных сумок.

СКАЧАТЬ БЕСПЛАТНО ОБРАЗЕЦ ОТЧЕТА: https://www.marketsandresearch.biz/sample-request/177225

Ключевые компании, рассмотренные в отчете:

  • Эверласт
  • Век ооо
  • Рингсайд
  • Maxxmma
  • Outslayer
  • Клето Рейес
  • RDX Спорт
  • Титул бокс
  • СУМКА ДЛЯ ТРЕНИНГА AQUA
  • Балаж Фитнес

В зависимости от типа продукта в отчете отображается:

В зависимости от приложения отчет делит рынок на:

  • Фитнес-студии и тренажерные залы
  • Тренировочные и спортивные центры
  • Школы и университеты
  • Другие

Затем в отчете включаются и анализируются самые последние рыночные события, определяющие будущее ведущих игроков и отрасли.В следующем разделе отчета каждый сегмент рынка, такой как тип, приложение и конечный пользователь, демонстрируется в проницательной организации. В отчете представлена ​​важная информация о влияющих факторах, движущих силах рынка, проблемах, возможностях и рыночных тенденциях как части глобальной динамики рынка скоростных сумок.

ДОСТУП К ПОЛНОМУ ОТЧЕТУ: https://www.marketsandresearch.biz/report/177225/global-speed-bags-market-2021-by-manufacturers-regions-type-and-application-forecast-to-2026

Затем в отчете представлена ​​информация о конкурентных ситуациях и тенденциях, включая слияния, поглощения и расширение, рыночные доли ведущих игроков и уровень концентрации рынка.Читателям также может быть предоставлена ​​информация о производстве, выручке и средней цене от производителей. Все эти факторы тщательно изучаются, чтобы прийти к прогнозу рынка, который может помочь в построении инвестиционных стратегий на мировом рынке скоростных сумок.

Географически отчет разделен на несколько ключевых регионов:

  • Северная Америка (США, Канада и Мексика)
  • Европа (Германия, Франция, Великобритания, Россия, Италия и остальные страны Европы)
  • Азиатско-Тихоокеанский регион (Китай, Япония, Корея, Индия, Юго-Восточная Азия и Австралия)
  • Южная Америка (Бразилия, Аргентина, Колумбия и остальная часть Южной Америки)
  • Ближний Восток и Африка (Саудовская Аравия, ОАЭ, Египет, Южная Африка и остальные страны Ближнего Востока и Африки)

Кроме того, авторы отчета изучили регионы с потенциалом роста, чтобы помочь компаниям спланировать свои будущие инвестиции.В отчете подробно представлены тенденции производства и занятости на региональных и международных рынках, а также конкретные страны и регионы, влияющие на показатели глобального рынка скоростных сумок.

Настройка отчета:

Этот отчет можно настроить в соответствии с требованиями клиента. Пожалуйста, свяжитесь с нашим отделом продаж ([email protected]), который позаботится о том, чтобы вы получили отчет, соответствующий вашим потребностям. Вы также можете связаться с нашими руководителями по телефону + 1-201-465-4211, чтобы поделиться своими требованиями к исследованиям.

Свяжитесь с нами
Марк Стоун
Руководитель отдела развития бизнеса
Телефон: + 1-201-465-4211
Эл. Почта: [email protected]
Веб: www.marketsandresearch.biz

Это контент распространялся через службу распространения пресс-релизов CDN Newswire. По вопросам пресс-релиза пишите нам по адресу [email protected]

COMTEX_395753208 / 2657 / 2021-10-24T19: 22: 09

Есть ли проблемы с этим пресс-релизом? Свяжитесь с поставщиком исходного кода Comtex по адресу editorial @ comtex.com. Вы также можете связаться со службой поддержки клиентов MarketWatch через наш Центр поддержки клиентов.

Отдел новостей MarketWatch не участвовал в создании этого контента.

Отделение фотопериода от яровизации и покоя хмеля для глобального производства и скоростного разведения

Условия окружающей среды

Первичные измерения проводились в течение 2016–2018 годов в Центре садоводства при Университете штата Колорадо, Форт-Коллинз, штат Колорадо, где позволяла комбинация холодильников и теплиц с контролируемой средой для контролируемых исследований в определенных условиях.Условия в теплице были запрограммированы на заданную температуру воздуха 26 ° C в течение фотопериода и 20 ° C в темноте с 45-минутным шагом изменения температуры между ними, относительной влажностью 50% (RH;%) и дополнительным фотосинтетически активным излучением ( PAR) 100–200 мкмоль м −2 с −1 во время фотопериода (светодиодное освещение Philips, Амстердам, Нидерланды). Контроллеры были запрограммированы таким образом, чтобы обеспечить максимальное проникновение света (тканевую шторку снимали только тогда, когда интенсивное солнечное излучение и температуры требовали дополнительных усилий по охлаждению), где дневная PAR обычно составляла 800–1100 мкмоль м –2 с –1 .Дневные температуры в течение экспериментального периода в среднем составляли 26,4 ° C, но в некоторых случаях температура поднималась выше, несмотря на постоянное охлаждение. Дополнительная влажность обеспечивалась через испарительную охлаждающую подушку, а дневной дефицит давления насыщенного пара (VPD) составлял в среднем 1,4 кПа. Температуру воздуха и относительную влажность измеряли с помощью датчиков относительной влажности / температуры EHT и PAR с использованием датчиков потока фотонов AQO-S PAR, установленных в верхней части навеса (Decagon Devices, Pullman, WA, США).

Растительный материал

В ходе исследования использовали женские сорта семи сортов хмеля.Сорта были отобраны из общедоступных сортов, представляющих как ароматические, так и альфа-разновидности. Их происхождение, ориентировочное время сбора урожая и использование в пивоварении указано в таблице дополнительных данных S1. В пилотном эксперименте минимальное количество узлов для индукции цветения — чтобы не путать ювенильность с потенциалом цветения и количеством узлов в циклах урожая — определялось количественно по градиенту размеров растений и развитию видимых узлов. При этом растения с прогрессивно большим развитием узлов определяли количественно от основания растения до последнего видимого узла перед апикальной меристемой.Было определено, что все сорта в исследовании «созрели до цветения», когда ≥25 узлов видны глазу.

Эксперимент 1: естественно яровизированный подвой

В 2016 году зимние естественные яровизированные подвои сортов хмеля Cascade, Centennial, Chinook и Columbus были помещены в теплицу с контролируемой средой в ведра объемом 11 л. содержащий 100% перлит для садоводства с дополнительным PAR 100–200 мкмоль м –2 с –1 и увеличенным световым периодом для контроля продолжительности светового дня в 18 часов (светодиодное освещение Philips, Амстердам, Нидерланды).Контейнеры были размещены на расстоянии 0,61 м (внутри рядов) в ряды по 20 м на сорт с 1,52 м между рядами. После появления всходов побеги прореживались, и один бункер на контейнер был натренирован на веревочную решетку на приблизительно 0,5 м от начальной длины бункера. Таким образом, для побегов в этом исследовании было отведено 0,93 м 2 пространства на каждый побег, чтобы свести к минимуму взаимодействия между побегами в контейнере или между соседними растениями. Мы отмечаем, что, хотя не существует «стандартного» расстояния между побегами на единицу площади для хмеля, расчет плотности растений и урожайности в контролируемой среде в этом исследовании приравнивается к 10764 побегам на га −1 , что соответствует плотности посадки, полученной вручную по сравнению с механизированное производство хмеля 12 .Периодическое удлинение струны в вертикальном направлении позволило опустить основание растения вокруг контейнера для накопления роста и развития узлов. Этот метод допускал длину бункера более 10 м. Автоматическая ирригационная система обеспечивала достаточное количество питательных веществ и воды за счет подачи полного удобрения (15-2-24, Aagrozz Inc., Вустер, Огайо, США) через капельные эмиттеры с компенсацией давления (ML Irrigation Inc., Laurens, SC, США) . Первоначально все горшки поливали до насыщения и давали стечь в течение 18 часов, после чего емкость контейнера поддерживалась ежедневно.Белую пластиковую пленку разрезали и поместили на поверхность подложки, чтобы исключить испарение, и по мере необходимости опускали бункеры до тех пор, пока не появилось минимум 25 видимых узлов. Для борьбы с тлей, паутинным клещом и трипсом применялась биологическая защита растений с помощью Aphidius colemani , Phytoseiulus persimilis и Orius insidiosus соответственно (Biobest Group NV, Бельгия). После «созревания до цветения» фотопериод сокращался до 14 часов для индукции цветков, а затемнялись жалюзи для предотвращения светового загрязнения.

Рост растений и урожай шишек

Семь растений (n = 7) каждого сорта были случайным образом отобраны и еженедельно отбирались пробы для повторных измерений роста побегов и развития видимых узлов. Семь растений, которые повторно измеряли, обрабатывали как повторы в анализах, а оставшиеся растения каждого сорта случайным образом распределяли среди выбранных растений, чтобы они действовали как буферы. При сборе урожая побеги срезали на уровне субстрата и собирали вручную. Вес свежих шишек измеряли для каждой повторности, и четыре подвыборки шишек по 100 г были взяты от каждого сорта при уборке урожая на предмет содержания сухого вещества.Образцы взвешивали свежими, а затем немедленно сушили при 45 ° C на воздухе с принудительной подачей воздуха до достижения приблизительно 9% влажности. Затем образцы повторно взвешивали, герметично закрывали в прозрачных пластиковых пакетах и ​​хранили при 2 ° C для определения химических компонентов. Урожайность шишек на повторность побега рассчитывалась для каждого сорта.

Анализ конической кислоты

Содержание α- и β-кислот определяли спектрофотометрическим методом Американского общества химиков-пивоваров 27 .Шишки каждого высушенного образца измельчали ​​до мелкого порошка для каждого сорта, и гомогенизированный образец экстрагировали из партии высушенного сырого хмеля; 2,5 г высушенного порошка хмеля взвешивали с точностью до мг и помещали в химический стакан на 100 мл с 50,0 мл метанола. Аликвоту перемешивали в течение 30 мин при комнатной температуре, а затем экстракт подвергали принудительной фильтрации через центрифугу для удаления твердых частиц. Аликвоту фильтрата объемом 50 мкл помещали в мерную колбу на 25 мл, а затем колбу наполняли метанольным раствором NaOH (0.5 мл 6 М NaOH в 250 мл метанола). Аликвоту этого раствора помещали в кварцевую кювету диаметром 1 см, и значения ее поглощения получали для длин волн 275, 325 и 355 нм против холостого опыта 50 мкл метанола в 25 мл метанольного NaOH (спектрофотометр Hach 6000; Loveland, Колорадо, США).

Эксперимент 2: неяровизированный подвой

После завершения цикла посева и сбора шишек в эксперименте 1 подвои «Cascade», «Centennial», «Chinook» и «Columbus» вернулись к 18-часовому фотопериоду и позволили прорастить новые побеги в контролируемой среде.Новые проросшие побеги либо собирали как черенки хвойных пород (для опыта 3), либо прореживали до одного побега на контейнер для перехода к следующему циклу сбора урожая. Таким образом, новые однолетние побеги выросли из подвоев, которые не были восстановлены ни под воздействием атмосферного охлаждения, ни в фазе покоя ризосферы. Установленные условия выращивания, рост побегов, урожай шишек и кислотный анализ были такими же, как в эксперименте 1.

Эксперимент 3: неяровизированные черенки хвойных пород

черенки хвойных пород ‘Cascade’, ‘Centennial’, ‘Chinook’ , и Columbus собирали, как описано ранее.Черенки длиной в два узла (нижняя пара листьев удалена) укореняли в аэропонном пропагаторе (Ez-clone Inc., Сакраменто, Калифорния, США) при pH воды 6,0. Двух недель было достаточно для развития корневой системы. Укоренившиеся черенки пересаживали в ведра бато, как описано ранее, и сразу же выращивали до зрелости при фотопериоде 18 часов. При этом укоренившийся побег не переходил в фазу покоя, а новый побег и корневая система не подвергались атмосферному или ризосферному охлаждению. Условия выращивания побегов мягкой древесины, рост, урожайность шишек и анализ кислоты были такими же, как в эксперименте 1.

Эксперимент 4: неяровизированные проростки тканевой культуры

Мы выращивали сорта Cascade, Centennial, Chinook, Galena и Willamette из проростков, размноженных культурой ткани (Summit Plant Labs Inc., Fort Collins, Колорадо, США). Культивируемые проростки не выходили из фазы покоя и не подвергались охлаждению. Условия выращивания, рост, урожайность шишек и кислотный анализ для культуры ткани, созданной побегами, были такими же, как в эксперименте 1.

Эксперимент 5: контролируемая температура яровизация и покой

После одного цикла культур мы искусственно яровизировали подмножество «Каскад». , «Centennial», «Chinook», «Galena» и «Willamette» в темных условиях в холодильнике при 3 ° C.После минимум 6 недель охлаждения и покоя контейнеры вынимали из холодильника и помещали в теплицу на 18-часовой световой период. Условия выращивания, рост, урожайность шишек и анализ кислоты были такими же, как в эксперименте 1.

Эксперимент 6: последовательные циклы посевов без яровизации

Мы выращивали cv. «Каскад» и «Кашемир» в дабл и cv. «Столетие» в четырех последовательных циклах урожая. При этом подвои не восстанавливались под воздействием атмосферного охлаждения или фазы покоя ризосферы от одного цикла посева к другому.В каждом сельскохозяйственном цикле условия выращивания, рост, урожайность шишек и анализ кислоты были такими же, как в эксперименте 1.

Статистический анализ

Данные реакции растений были проанализированы с помощью SPSS (IBM Analytics, www.ibm.com/analytics/, США) . Односторонний дисперсионный анализ (ANOVA) (опыт 1–3, 6 — сорт Centennial) и t-критерий (опыт 4–5, 6 — сорта «Каскад» и «Кашемир») были использованы для анализа значимость основных эффектов. Различия между средними считались значимыми, когда значение P теста ANOVA F или значение t было <0.05. Каждое отслеживаемое растение было экспериментальной единицей и рассматривалось как копия в экспериментах 1–6 (n = 7).

Облака могут ускорить глобальное потепление

Один из самых фундаментальных вопросов об изменении климата также является одним из самых острых: насколько точно Земля нагреется в ответ на будущие выбросы парниковых газов?

Ответ, по словам ученых, лежит в небе над нашими головами. Облака — пушистые, маловероятные привратники изменения климата — они играют решающую роль в том, насколько быстро мир нагревается.

Серия недавних исследований пролила новый свет на эту роль. По мере потепления в мире облачный покров будет меняться по всему миру. И эти меняющиеся облака, вероятно, ускорят глобальное потепление.

Это означает, что Земля может быть немного более чувствительной к парниковым газам, чем можно было предположить по некоторым более ранним оценкам.

«Облака — это большая неопределенность», — сказал Пауло Чеппи, климатолог из Имперского колледжа Лондона и соавтор одного из новых исследований. «Итак, это была основная мотивация.Мы хотим понять, как изменятся облака и как обратная связь с облаками повлияет на глобальное потепление ».

Облачные исследования — дело непростое. Иногда облака оказывают согревающее воздействие на местный климат, а иногда — охлаждающее — все зависит от типа облаков, местного климата и множества других условий.

Изменение климата только усложняет дело. Ожидается, что глобальное потепление приведет к увеличению количества облаков одних типов в одних местах и ​​их уменьшению в других.В общем, это большое и сложное лоскутное одеяло эффектов по всему миру.

В течение многих лет ученые изо всех сил пытались определить, как именно облака изменятся с будущим потеплением — и усугубят ли они изменение климата или могут ослабить некоторые из его последствий. Это был сложный вопрос. Ученые обычно используют компьютерные модели для предсказания будущего изменения климата. Но, как известно, облака сложно смоделировать, особенно в глобальном масштабе.

Однако за последние несколько месяцев несколько исследований начали разбираться в этом.Все они приходят к одним и тем же выводам: некоторые из наихудших сценариев глобального потепления могут оказаться менее вероятными, чем думали ранее ученые. Но и некоторых из лучших сценариев тоже точно не будет.

Все эти исследования сосредоточены на одном и том же вопросе: насколько, собственно, нагрелся бы мир, если бы концентрация углекислого газа в атмосфере увеличилась вдвое по сравнению с доиндустриальными уровнями?

Это пока гипотетический вопрос. Но вскоре это могло измениться.

До промышленной революции, около 150 лет назад, глобальный уровень углекислого газа колебался около 280 частей на миллион. Удвойте это будет 560 частей на миллион. Сегодня концентрации уже превышают 410 промилле и растут с каждым годом.

Этот вопрос об удвоении CO2 — показатель, известный ученым как «равновесная чувствительность климата» — был центральным вопросом среди исследователей климата на протяжении десятилетий.

Это тоже было непросто.

В 1979 году в основополагающем отчете Национальной академии наук говорилось, что планета, вероятно, нагреется где-нибудь от 1.От 5 до 4,5 градусов Цельсия в ответ. В течение многих лет исследование за исследованием приходили более или менее к одному и тому же выводу.

Только недавно исследователи начали сужать круг вопросов, и улучшения в исследованиях облачных вычислений во многом связаны с этим.

В прошлом году новаторское новое исследование показало, что удвоение выбросов CO2, вероятно, приведет к потеплению где-нибудь от 2,6 до 3,9 градусов по Цельсию.

Это существенно более узкая проекция, исключающая некоторые из более высоких прогнозов и устраняющая большую часть более низкого диапазона.В исследовании собраны воедино все самые последние исследования чувствительности климата с учетом множества различных доказательств, в том числе недавних достижений в исследованиях облаков.

И за последние несколько месяцев несколько недавних исследований, сосредоточенных в основном на облаках, также подтвердили более узкий диапазон чувствительности климата.

Февральское исследование в журнале Nature Climate Change показало вероятную чувствительность около 3,5 C. В майском исследовании, также в Nature Climate Change , было указано около 3 C.Оба исследования показали, что облака в мировом масштабе, вероятно, будут иметь умеренный усиливающий эффект на скорость глобального потепления.

В этих исследованиях были сделаны выводы с использованием реальных наблюдений. Они собрали большие объемы данных о поведении облаков — о том, как облака реагируют на изменения температуры, влажности и других погодных переменных, — а затем провели статистический анализ этих наблюдений, чтобы выяснить, как облака могут реагировать на изменение климата в будущем.

По словам Марка Зелинки, климатолога и эксперта по облакам из Ливерморской национальной лаборатории Лоуренса, соавтора майского и прошлогоднего исследования, это довольно традиционный способ решения проблемы.

В более новом исследовании, с другой стороны, использовался менее традиционный подход. В исследовании, опубликованном на прошлой неделе в Proceedings of the National Academy of Sciences , использовалось машинное обучение, чтобы выяснить, как облака реагируют на изменения в их среде.

Машинное обучение — это ветвь искусственного интеллекта, в которой компьютеры просеивают большие объемы данных, выявляют закономерности, а затем используют эти шаблоны для построения алгоритмов, которые предсказывают, как будущие данные должны вести себя в различных условиях.В этом случае исследователи использовали реальные наблюдения за тем, как облака реагируют на изменение окружающей среды.

Подход машинного обучения пришел к аналогичному выводу: более узкая чувствительность климата, что исключает большинство сценариев с более мягким климатом. Исследование показало, что вероятность того, что климат будет ниже 2 ° C, практически исключена.

«Какое-то время я думал, что проблема облака особенно подходит для подходов к машинному обучению», — сказал Сеппи, который проводил исследование с коллегой-климатологом и экспертом по машинному обучению Пиром Новаком.«Если вы хотите понять взаимосвязь между облаками и температурой, влажностью или ветром, довольно сложно выделить отдельные эффекты каждой из этих переменных окружающей среды».

Машинное обучение может быть более простым способом справиться с таким сложным набором данных, сказал он.

Машинное обучение перспективно и в других исследованиях облачных вычислений. Некоторые исследовательские группы экспериментируют с включением компонентов машинного обучения в глобальные климатические модели, чтобы обойти трудности моделирования облаков.

Облака представляют собой проблему для моделей, потому что они требуют чрезвычайно мелкомасштабной физики — в конце концов, облака образуются из крошечных капелек воды в небе. Моделирование этих микроскопических процессов в глобальном масштабе потребует невообразимого уровня вычислительной мощности; это просто невозможно.

Чтобы обойти это, разработчики моделей обычно не заставляют свои модели физически моделировать образование облаков. Вместо этого они вручную добавляют информацию о том, как облака должны формироваться и реагировать на изменения в их среде, — тактика, известная как параметризация.

Машинное обучение может быть альтернативой параметризации. Вместо того, чтобы вводить правило о том, как облака должны вести себя в модели, компонент машинного обучения может создавать алгоритмы, которые предсказывают, как облака должны реагировать.

Это еще не совсем обычная стратегия. Но несколько исследовательских групп за последние несколько лет начали исследовать, насколько это может быть полезно.

Это многообещающие достижения в сложной области облачных исследований. Тем не менее, «машинное обучение — очень полезный инструмент, но не панацея», — предупредил Пирс Форстер, директор Международного центра климата Пристли при Университете Лидса, в электронном письме E&E News.

Машинное обучение — это эффективный способ анализа сложных наборов данных, но он может оставить без ответа некоторые вопросы о физических процессах, лежащих в основе этих данных. Есть еще много возможностей для более традиционных исследований того, как и почему поведение облака.

«Я считаю, что скоординированные разработки на обоих фронтах — это ответ», — добавил Форстер.

Между тем, добавила Зелинка, обнадеживает тот факт, что разные стратегии пришли к схожим выводам.

«Если бы это было всего одно исследование, вы могли бы усомниться в надежности этого результата», — сказала Зелинка. «Но если у вас появляется все больше и больше свидетельств от независимых авторов, использующих независимые методы, и все они приходят к одинаковому выводу, это довольно убедительно».

Global Water WE550 Датчик скорости ветра

Доставка, доставка, обработка заказа и наличие продукта

Fondriest пользуется услугами лучших перевозчиков, чтобы заказы приходили к вам вовремя. Узнайте больше о сроках доставки, способах, стоимости и перевозчиках.

Срок поставки

Мы держим вас в курсе. Вскоре после того, как вы разместите свой заказ, вы получите электронное письмо с подтверждением заказа, чтобы подтвердить детали вашего заказа, включая доставку и смету доставки. Как только ваш заказ будет подготовлен к отправке и отправке, вы получите электронное письмо с уведомлением об отправке с информацией о перевозчике и отслеживании.

Стоимость отгрузки и доставки

Срок отправки — это примерное время, когда товар будет отправлен с нашего склада.Все товары будут отправлены за один раз, если вы специально не запросите частичную доставку. В этом случае товары из вашего заказа будут отправлены по мере их поступления. Срок доставки — это примерное время, когда товар будет доставлен на ваш адрес доставки после его отправки. Расчетное время доставки зависит от способа доставки, который вы выбираете при оформлении заказа. Все оценки основаны на рабочих днях.

Варианты доставки

Fondriest предлагает несколько удобных вариантов доставки.

Стандартная доставка: Товары, отправленные стандартным сервисом, обычно доставляются в течение пяти рабочих дней после отправки.
2-дневная доставка: За дополнительную плату Fondriest предлагает этот вариант ускоренной доставки для большинства продуктов. Товары отправляются через двухдневную службу до 16:00. EST обычно доставляется до 16:30. по местному времени через два рабочих дня после отгрузки.
Ночная доставка: За дополнительную плату Fondriest предлагает этот вариант ускоренной доставки для большинства товаров. Товары отправлены до 16:00. EST через ночную службу обычно доставляется до 16:00. по местному времени через один рабочий день после отгрузки. Свяжитесь с Fondriest для получения информации о более ранней доставке в ночное время.
Ваш аккаунт: Fondriest предлагает бесплатную доставку на ваш счет наиболее популярным перевозчикам.

Помните, что эти оценки относятся только к времени в пути и не применяются до тех пор, пока продукт не покинет склад Fondriest. Поскольку Fondriest не может контролировать доставку вашего заказа после того, как ваш заказ покинет склад Fondriest, мы не можем нести ответственность за просрочку доставки, независимо от указанного вами способа доставки.

Подпись требуется для большинства доставок

Большая часть посылок Fondriest содержит ценное оборудование.Если вы не будете по адресу доставки, чтобы принять доставку вашего продукта, подумайте о том, чтобы отправить товар по адресу, где кто-то, кому вы доверяете, будет доступен, чтобы подписать вашу посылку, или примите вашу посылку, если подпись не требуется для доставки. После того, как ваш заказ подготовлен к отправке или отправлен, мы не сможем изменить адрес доставки. Право собственности и риск потери всех продуктов переходят к вам при доставке. Если вы готовы взять на себя риск доставки вашего заказа без подписи, вы можете уполномочить Fondriest организовать доставку, которая не требует присутствия кого-либо по адресу доставки.

Недоставленных пакетов

Иногда посылки возвращаются в Fondriest как недоставленные. Когда перевозчик возвращает в Fondriest посылку, которую невозможно доставить, свяжитесь с нами, чтобы организовать повторную отправку.

Неудачные попытки доставки

Большинство перевозчиков Fondriest делают три попытки доставить посылку. После трех попыток доставки курьер вернет посылку в Fondriest.

Обработка заказов

Предполагаемая дата отгрузки вашего заказа зависит от наличия продукта, времени обработки платежа и времени обработки на складе и не включает время доставки.Мы не начинаем обработку платежей до тех пор, пока Fondriest не получит всю необходимую информацию, а также полную оплату или полную авторизацию в случае кредитной карты или заказов на аренду.

Fondriest начнет обработку платежей по заказам, размещенным в выходные или праздничные дни, на следующий рабочий день. Рабочие дни с понедельника по пятницу, кроме государственных праздников.

Ваш заказ на товары, имеющиеся в наличии, которые могут быть отправлены в тот же день, должен быть получен до 14:00 по местному времени.м. в ожидании обработки платежа, чтобы в течение дня оставалось достаточно времени для отправки вашего заказа.

Наличие товара

Fondriest прилагает все усилия, чтобы доставить ваш продукт в соответствии с предполагаемыми сроками поставки. Расчетное время выполнения заказа указано в рабочих днях (с понедельника по пятницу, кроме государственных праздников).

Хотя Fondriest прилагает все усилия, чтобы отправить ваш заказ в соответствии с указанным сроком поставки, даты отгрузки могут измениться из-за изменений в поставках.Если время выполнения заказа изменится, Fondriest свяжется с вами по электронной почте и предоставит пересмотренную смету доставки.

Fondriest прилагает все усилия для поставки заказанных вами продуктов, но могут быть случаи, когда Fondriest подтверждает заказы, а позже узнает, что не может поставить продукты ни вообще, ни в заказанном количестве. Эти редкие случаи могут включать, когда Fondriest узнает, что продукты больше не производятся или становятся недоступными по иным причинам, когда Fondriest не может получить компоненты для заказанной вами конфигурации или когда в интернет-магазине Fondriest произошла ошибка ценообразования.

В таких случаях Fondriest проинформирует вас и, если вы заинтересованы, Fondriest может предложить альтернативные продукты, которые могут удовлетворить ваши потребности. Если вы не хотите заказывать альтернативные продукты, Fondriest отменит ваш заказ на продукты, которые не могут быть поставлены, а также на любые другие продукты, которые вы больше не хотите заказывать в результате, и вернет вам стоимость покупки.

Глобальное увеличение скорости репликационной вилки во время переключения судеб эритроидных клеток, регулируемых p57KIP2.

ВВЕДЕНИЕ

Время и выполнение решений о судьбе онтогенетических клеток не полностью изучены.Клеточный цикл участвует в таких решениях через взаимодействия между клеточным циклом и регуляторами транскрипции ( 1 3 ) и через специфическую для фазы клеточного цикла восприимчивость к сигналам дифференцировки ( 4 7 ). Реконфигурация клон-специфичных локусов хроматина, являющаяся предпосылкой для выполнения решений клеточной судьбы, была выдвинута гипотезой, требующей S-фазы, потому что прохождение репликационной вилки временно разрушает нуклеосомы ( 8 , 9 ).Однако онтогенетические переходы и связанные с ними динамические изменения хроматина возможны в отсутствие S-фазы ( 10 15 ). Несмотря на эти данные, S-фаза важна для активации или подавления некоторых генов у дрожжей ( 16 , 17 ) и для подмножества решений клеточных судеб у метазоа ( 18 22 ), хотя точная роль и лежащие в основе механизмы, связывающие S фазу с этими решениями, остаются неясными. Мы недавно идентифицировали зависимое от S фазы решение судьбы клеток, которое контролирует переход от самообновления к дифференцировке в эритроидном клоне мышей ( 23 ).Эритроидные предшественники на стадии колониеобразующей единицы эритроид (CFUe) ( 24 ) претерпевают ряд самообновляющихся клеточных делений перед переходом в фазу активной транскрипции эритроидного гена, известной как терминальная дифференцировка эритроида (ETD), во время которой они созревают в эритроциты, претерпевая от трех до пяти дополнительных клеточных делений. Переход от самообновления к ETD жестко регулируется, поскольку он определяет количество предшественников CFUe и выход эритроидов ( 24 , 25 ).Многие факторы транскрипции, которые управляют ETD, включая GATA-1, Tal-1 и Klf1, хорошо охарактеризованы ( 26 , 27 ). Однако клеточный контекст и сигналы, которые определяют время их активации, недостаточно изучены. Чтобы ответить на эти вопросы, мы изучили фетальную печень мыши, эритропоэтическую ткань, богатую предшественниками эритроидов. Наша недавняя работа с использованием этой модельной системы показала, что переход от самообновляющихся CFUe к ETD in vivo совпадает с активацией маркера клеточной поверхности CD71, что делает его доступным для молекулярных исследований ( 23 ).Мы обнаружили, что ETD активируется во время ранней S-фазы при быстром переключении клеточной судьбы, которое включает ряд одновременных событий обязательства, включая начало зависимости от гормона эритропоэтина (Epo) для выживания, реконфигурацию хроматина ( 23 ) и необычный процесс глобального деметилирования ДНК ( 28 ). Эти обязательные события зависят от прогрессирования S-фазы, потому что их индукцию можно обратимо предотвратить путем обратимой остановки репликации ДНК ( 23 ).Здесь мы исследуем потребность в прогрессии S-фазы во время этого переключения клеточной судьбы, спрашивая, может ли S-фаза во время переключения отличаться от S-фазы в предыдущих циклах. Ранее мы отмечали, что переключение на ETD совпадает с увеличением скорости внутри-S-фазного синтеза ДНК, возможно, указывая на более короткую S-фазу ( 23 , 28 ). Хотя длина фазы G 1 хорошо задокументирована как регуляторная мишень для факторов роста и сигналов дифференцировки ( 4 , 7 ), гораздо меньше известно о регуляции длины S-фазы у млекопитающих.Напротив, хорошо изученные циклы расщепления после оплодотворения модельных организмов, таких как лягушка и Drosophila , длятся всего несколько минут и включают чрезвычайно короткую S-фазу; S-фаза резко удлиняется при переходе к середине бластулы ( 29 32 ). Это заметное изменение длины S-фазы является результатом измененной эффективности запуска источников репликации, которые переходят от синхронного и эффективного возбуждения во время коротких циклов расщепления к асинхронному и менее эффективному запуску при переходе в среднюю бластулу ( 30 , 33 ).Хотя гораздо меньше известно о возможной регуляции длины S-фазы во время развития млекопитающих, более старые сообщения отметили временное укорочение S-фазы во время принятия решений о судьбе ключевых клеток, включая укорочение S-фазы до 34 36 ). Значение измененной продолжительности S-фазы для дифференцировки млекопитающих и лежащие в ее основе механизмы неизвестны. В этой работе мы определяем, что переход от CFUe к ETD влечет за собой временное укорочение S-фазы, частично регулируемое p57 KIP2 , a член семейства Cip / Kip ингибиторов циклин-зависимой киназы (CDK) (CDKI) ( 37 40 ).Что касается новой функции этого белка, мы обнаружили, что p57 KIP2 продлевает продолжительность S-фазы в самообновляющихся предшественниках, функция, важная для их жизнеспособности как in vivo, так и in vitro. Механизм, контролирующий длительность S-фазы, не включает измененное срабатывание источников репликации, а вместо этого изменяет скорость вилок репликации. В присутствии p57 KIP2 вилки репликации работают медленнее; p57 KIP2 понижающее регулирование с активацией ETD приводит к глобально более быстрым вилкам.

ОБСУЖДЕНИЕ

Мы описываем резкое изменение продолжительности S-фазы и лежащей в основе динамики репликации ДНК, неотъемлемой части решения судьбы эритроидных клеток, зависящей от S-фазы. Мы показываем, что переход от самообновления к ETD в предшественниках CFUe влечет за собой быстрое увеличение скорости внутри-S-фазного синтеза ДНК, что приводит к сокращению S-фазы на 40%. Сокращение S-фазы является результатом резкого глобального увеличения процессивности репликационных вилок. Мы идентифицируем CDKI p57 KIP2 как основной регулятор этого процесса.p57 KIP2 экспрессируется в S-фазе самообновляющихся предшественников CFUe, где благодаря новым функциям этого белка он ограничивает скорость репликационных вилок, защищая клетки от связанных с репликацией повреждений ДНК и поддерживая жизнеспособность клеток. p57 KIP2 понижающая регуляция во время переключения на ETD вызывает наблюдаемое увеличение скорости репликационной вилки и более короткую S-фазу. Наконец, мы показываем, что ингибирование CDK с помощью p57 KIP2 является вероятным медиатором его функций S-фазы.

Три независимые линии доказательств подтверждают наш вывод о том, что S-фаза становится быстрее и короче во время этого переключения клеточной судьбы. Во-первых, скорость внутри-S-фазного синтеза ДНК, измеренная по скорости включения BrdU, увеличилась на ~ 50% (рис. S1) ( 23 , 28 ). Во-вторых, метод двойной дезоксинуклеозидной метки, который измеряет долю клеток, покидающих S-фазу в течение известного временного интервала, независимо подтвердил укорочение S-фазы, от 7 до 4 часов (рис. 1). В-третьих, мы обнаружили глобальное увеличение скорости репликационных вилок на ~ 50%, измеренное с помощью расчесывания ДНК (рис.6 и рис. S8A). В дополнение к этим находкам in vivo, активация ETD в Dex-зависимых культурах CFUe in vitro также тесно связана с укорочением S-фазы (рис. 5F) — процессом, который аналогичным образом вызывается глобальным увеличением скорости репликационной вилки (рис. .S8C). Хорошо известно, что репликация ДНК перепрограммируется во время дифференцировки, что отражается в изменениях в использовании источников репликации и во времени репликации доменов хроматина ( 67 69 ). Наша работа показывает, что, кроме того, переход от самообновления к дифференциации фундаментально изменяет программу репликации в дополнительном ключевом отношении за счет глобального увеличения скорости репликационной вилки.У модельных организмов заметные изменения продолжительности S-фазы в процессе развития были четко связаны с изменениями в исходном возбуждении ( 30 ). Скорость репликационных вилок была задействована как регуляторная мишень в ответе на повреждение ДНК ( 70 73 ), но не в решениях о развитии в нормальной физиологии. Недавний отчет о более быстрых вилках в В-клетках зародышевого центра, получающих помощь Т-клеток ( 74 ), вместе с нашими открытиями здесь в эритроидных предшественниках, повышает вероятность того, что регуляторные изменения глобальной скорости вилок могут быть неотъемлемой частью физиологических программ развития млекопитающих. .В настоящее время неясно, как более высокая скорость синтеза ДНК может повлиять на метаболизм хроматина. Ранее мы обнаружили, что быстрое увеличение скорости внутри-S-фазного синтеза ДНК при переходе S0 / S1 необходимо для необычного процесса зависимого от репликации глобального деметилирования ДНК, которое функционирует для ускорения транскрипции эритроидных генов ( 28 ). Таким образом, интригующая возможность состоит в том, что повышенная скорость репликационной вилки снижает эффективность метилирования ДНК и потенциально изменяет др. Зависимые от метилирования ДНК эпигенетические метки, тем самым влияя на судьбу клеток.Повышенная скорость вилки сама по себе, хотя и необходима, недостаточна для ускорения решения клеточной судьбы, поскольку клетки S0 с дефицитом p57 KIP2 , по-видимому, не претерпевают преждевременного ETD, несмотря на их преждевременно высокую скорость синтеза ДНК. -фазовая функция для CDKI p57 KIP2 . p57 KIP2 является установленным отрицательным регулятором перехода от G 1 к S-фазе, хотя было показано, что он ассоциируется и ингибирует как G 1 -, так и S-фазу комплексы циклин / CDK in vitro ( 37 , 38 ).Здесь мы представляем несколько линий доказательств, убедительно подтверждающих, что p57 KIP2 удлиняет S фазу за счет глобального подавления процессивности репликационной вилки. Мы обнаружили, что мРНК и белок p57 KIP2 специфически экспрессировались в S-фазе S0 CFUe (рис. 2, от A до C). Нокдаун (фиг. 2, D и E) или экзогенная сверхэкспрессия p57 KIP2 в этих клетках (фиг. 2F и фиг. S2) соответственно изменяли внутри-S-фазный синтез ДНК дозозависимым образом. Наконец, у эмбрионов, удаленных из p57 KIP2 , скорость внутри-S-фазного синтеза ДНК и общая скорость вилки были увеличены примерно на 50% в S0-клетках in vivo (рис.4, A и B, и 6, от C до E) и in vitro (рис. 5F и рис. S8C). В отличие от p21 CIP1 , который взаимодействует с PCNA, чтобы замедлить репликационные вилки во время ответа на повреждение ДНК ( 57 , 75 ), замедление S-фазы с помощью p57 KIP2 зависит от его связывания и вероятного ингибирования комплексов циклин / CDK (рис. S6). Таким образом, наша работа предполагает, что помимо известной потребности в активности CDK в срабатывании ориджина ( 62 , 63 ), она также регулирует процессивность репликационных вилок.Дальнейшая работа потребуется для проверки этой гипотезы и определения критических мишеней CDK. Мы обнаружили, что p57 KIP2 способствует жизнеспособности самообновляющихся предшественников CFUe в S0 in vivo (рис. 3G) и in vitro (рис. 5D и рис. S5). Жизнеспособность и самообновление были восстановлены до p57 KIP2 -дефицитных КОЕ in vitro ретровирусной трансдукцией p57 KIP2 (фиг. 5H) или обработкой препаратом-ингибитором CDK росковитином (фиг. 5I), демонстрируя клеточно-автономную и клеточно-специфическая, ингибирующая CDK роль p57 KIP2 в этих функциях.Кажущееся парадоксальным требование ингибирования CDK при экспансии CFUe может быть объяснено, по крайней мере частично, стрессом репликации, который приводит к его отсутствию. Стресс репликации, который влечет за собой замедление или остановку развития репликационной вилки и / или синтеза ДНК ( 70 ), проявляется в клетках с дефицитом p57 KIP2 из-за увеличенного числа γh3AX-положительных клеток, которые в значительной степени задерживаются в S-фазе. цикла (рис. 4, C — F, а также 5G и рис. S3). Следовательно, ограничивая скорость репликационных вилок, p57 KIP2 защищает клетки CFUe от стресса репликации и способствует их жизнеспособности.В отличие от клеток S0, клетки S1 не подвергаются усиленному апоптозу, несмотря на их более быстрые репликационные вилки. Кроме того, клетки S1 имеют более низкие уровни γh3AX, чем клетки S0. Поэтому будет интересно исследовать, влечет ли переход от S0 к S1 адаптацию, которая сохраняет жизнеспособность этих клеток перед лицом более быстрых вилок. Тем не менее, ранее мы обнаружили, что клетки на переходе S0 / S1 особенно чувствительны к гидроксимочевине ( 23 ), это открытие можно объяснить повышенной скоростью репликационных вилок.Эти новые S-фазные функции p57 KIP2 могут также лежать в основе апоптоза и аномального развития неэритроидных тканевых предшественников у эмбрионов p57 KIP2 ( 48 , 49 ) и у пациентов с синдромом Беквита-Видемана, вторичным по отношению к p57 KIP2 мутации ( 76 , 77 ). В частности, гемопоэтические стволовые клетки (HSC), дефицитные по p57 KIP2 , имеют серьезный дефицит способности к самообновлению, что ухудшает их способность приживаться и объясняется пониженным покоем ( 78 , 79 ).Наша работа предполагает, что, кроме того, p57 KIP2 может усиливать самообновление HSC за счет ограничения скорости внутри-S-фазного синтеза ДНК и уменьшения повреждений ДНК, связанных с репликацией. Открытие того, что p57 KIP2 является важным медиатором Dex-зависимых культур экспансии CFUe, дает новое понимание механизма, с помощью которого глюкокортикоиды поддерживают эти культуры, и имеет потенциальное трансляционное значение для развития массового производства эритроидных предшественников in vitro, что полагаться на эту систему культивирования ( 52 , 80 ).

В заключение, наша работа раскрывает ранее неизвестную регуляцию динамики репликации S-фазы, которая является неотъемлемой частью состояний развития клеток в эритроидном клоне. Это показывает, что ингибирование CDK и медленные вилки важны для жизнеспособности самообновляющихся предшественников и что быстрое глобальное увеличение скорости вилки происходит с переключением на дифференциацию. Он идентифицирует Cip / Kip CDKI белок p57 KIP2 как регулятор скорости вилки и поднимает возможность аналогичных механизмов, действующих во время других случаев S-фазозависимых решений клеточной судьбы.

МАТЕРИАЛЫ И МЕТОДЫ

Мыши

Самок мышей, гетерозиготных по делеции гена cdkn1c (B6.129S7-Cdkn1 ctm1Sje / J, инвентарь лаборатории Джексона № 000664), были скрещены с C57BL дикого типа. мышей или гетерозиготных мышей-самцов cdkn1c. Все эксперименты проводились с контрольными эмбрионами дикого типа с недостаточностью p57 KIP2 . Все эмбрионы были генотипированы перед дальнейшей обработкой печени плода.

Выделение и проточно-цитометрический анализ предшественников эритроидов

Печень плода собирали из эмбрионов мышей среднего возраста (E12.5 — E13.5), механически диссоциированный, меченный антителами к CD71 и Ter119 и маркерами клонального происхождения и сортированный проточной цитометрией, как описано ( 23 , 81 ). Клетки сортировали на FACSAria (BD Biosciences) с использованием насадки 100 мкм. Проточный цитометрический анализ проводили на цитометре LSR II (BD Biosciences). Данные FACS анализировали с помощью программного обеспечения FlowJo (Tree Star Inc.). В некоторых экспериментах клетки S0 выделяли из клеток печени плода с использованием магнитных шариков EasySep (StemCell Technologies) путем отрицательной сортировки на CD71, Ter119, Gr1, Mac1 и CD41.

Антитела, используемые в проточной цитометрии и очистке EasySep

Следующие антитела были использованы в проточной цитометрии и очистке EasySep: фикоэритрин (PE) / Cy7 крысиный антимышиный CD71 (RI7217) (BioLegend 113812), PE крысиный антимышиный Ter119 (Ter119 ) (BD Biosciences 553673), аллофикоцианин (APC) крысиный антимышиный Ter119 (Ter119) (BD Biosciences 557909), APC крысиный антимышиный Ter119 (Ter119) (BD Biosciences 557909), крысиный биотин против мышиного CD71 (C2) ( BD Biosciences 557416), крысиный биотин с антимышиным Ter119 (BD Biosciences 553672), крысиный биотин с антимышиным Ly-6G и Ly-6C / Gr1 (RB6-8C5) (BD Biosciences 553125), крысиный биотин с антимышиным CD11b / Mac1 (M1 / 70) (BD Biosciences 557395), крысиный биотин против мышиного CD41 (MWReg30) (Thermo Scientific MA1-82655), флуоресцеина изотиоцианат (FITC) крысиный антимышиный Ly-6G и Ly-6C / Gr1 (RB6-8C5 ) (BD Biosciences 553127), FITC крысиные антимышиные CD11b / Mac1 (M1 / 70) (BD Biosciences 557396), FITC крысиные антимышиные CD41 (MWReg30) (BD Biosciences 553848), крысиные антимышиные FITC CD45R / B220 (RA3-6B2) (BD Biosciences 553087), FITC антимышиный анти-мышиный CD3e (145-2C11) (BD Biosciences 553061), PE аннексин V (BD Biosciences 556421) и мышиный анти-h3AX Alexa Fluor 488 (pS139 ) (N1-431) (BD Biosciences 560445).

Выделение клеток G

1 — и S-фазы из субпопуляций эритроидов S0 и S1

Печень плода E13.5 была получена от мышей BALB / cJ дикого типа (инвентарный номер лаборатории Джексона 000651), механически диссоциированных, ресуспендированных при 10 6 клеток / мл и выдерживается при 37 ° C в течение 15 мин с использованием модифицированной Исковской среды Дульбекко (IMDM) (l-глутамин, 25 мМ Hepes) (Gibco), 20% фетальной телячьей сыворотки (Gibco, HyClone), пенициллин / стрептомицин (100 Ед / мл; Invitrogen), 10 -4 M β-меркаптоэтанол (Sigma) и Epo (2 Ед / мл).Hoechst 33342 (5 мкг / мл; Invitrogen h4570) добавляли в течение 40 минут при 37 ° C. Клетки собирали, промывали и метили антителами к CD71, Ter119 и клональным маркерам, а также красителем жизнеспособности клеток 7AAD (BD Biosciences 559925). Затем клетки сортировали на FACSAria (BD Biosciences). G 1 — и клетки S-фазы в подмножествах S0 и S1 были заблокированы на основе содержания ДНК, что отражено флуоресценцией Hoechst.

Анализ клеточного цикла

Беременным самкам мышей в середине беременности инъецировали BrdU [200 мкл исходного раствора (10 мг / мл) в фосфатно-солевом буфере (PBS)] внутрибрюшинно.Эмбрионы E13.5 собирали через 30 мин. Для определения скорости репликации ДНК in vitro клетки подвергали импульсному воздействию при конечной концентрации 33 мкМ BrdU в течение 30 мин. Клетки немедленно метили с помощью набора LIVE / DEAD (Invitrogen L23105), фиксировали и повышали проницаемость. Подмножества эритроидов были идентифицированы с использованием анти-CD71 (BD Biosciences 113812) и анти-Ter119 (BD Biosciences 553673). Включение BrdU и содержание ДНК определяли с помощью конъюгированных с биотином анти-BrdU (Abcam ab171059), конъюгированных со стрептавидином APC (Invitrogen S868) и 7AAD (BD Biosciences 559925).

Измерение продолжительности S-фазы

Беременным самкам мышей внутрибрюшинно вводили 200 мкл EdU (3,3 моль / 25 г мыши), затем через 1 или 2 часа вводили BrdU (3,3 ммоль / 25 г мыши) и умерщвляли. 20 мин после второй инъекции. Печень плода метили маркерами происхождения Ter119 и CD71, и клетки S0 и S1 сортировали. Затем отсортированные подмножества метили с помощью набора LIVE / DEAD (Invitrogen L23105), фиксировали в 70% этаноле, денатурировали в 4 М соляной кислоте и промывали фосфатно-лимонным буфером.Включение EdU было обнаружено с помощью набора для проточной цитометрии Click-iT EdU Alexa Fluor 488 (Invitrogen C10425), а включение BrdU было обнаружено с использованием мышиных анти-BrdU Alexa Fluor 647 (Invitrogen B35133).

Культуры размножения КОЕ in vitro (

51 , 82 )

Для выделения Ter119-отрицательных клеток свежие клетки печени плода окрашивали конъюгированными с биотином антителами к Ter119 (BD Biosciences 553672) в соотношении 1: 100, с последующей магнитной сепарацией EasySep (StemCell Technologies).Клетки выращивали в бессывороточной среде StemPro-34 с добавлением питательной добавки (Invitrogen), 1 мкМ Dex (Sigma), фактора стволовых клеток (SCF) (100 нг / мл; PeproTech), инсулиноподобного фактора роста 1 (40 нг). / мл; PeproTech), Epo (2 Ед / мл), пенициллин / стрептомицин (100 Ед / мл; Invitrogen) и 2 мМ l-глутамина (Invitrogen). Клетки поддерживали на уровне 2 × 10 6 клеток / мл и ежедневно дополняли свежей средой и факторами роста. Чтобы проверить действие росковитина на клетки фетальной печени p57 KIP2 — / — в культуре размножения, клетки выращивали и поддерживали, как описано выше, с дополнительной ежедневной добавкой 0.5 мкМ росковитин (EMD Millipore 557360). Чтобы перейти на среду для дифференцировки, после выдерживания в среде для размножения в течение 4-5 дней Ter119-отрицательные клетки снова выделяли с использованием магнитных шариков EasySep (StemCell Technologies). Затем клетки переносили в IMDM (1-глутамин, 25 мМ Hepes) (Gibco), 20% фетальную сыворотку теленка (Gibco, HyClone), пенициллин / стрептомицин (100 Ед / мл; Invitrogen), 10 -4 M β- меркаптоэтанол (Sigma) и Epo (2 Ед / мл).

Ретровирусная трансдукция с помощью конструкций p57

Ретровирусные конструкции были созданы в основной цепи вектора MSCV-IRES-hCD4, как описано ( 23 ).Мутант p57 (p57T329A) был описан ранее ( 23 ). CDK-связывающие мутанты, дефектные по p57W50G и p57F52A / F54A, были получены с помощью ПЦР со следующими праймерами: CCAGAACCGCGGGGACTTCAACTTCC и TCCTCGGCGTTCAGCTCG (для p57W50G) и CGCCCAGCAGGATTTGTGCCTCTTC и TTGGGC52 для p57W50G и TTCGGC52. Всю открытую рамку считывания секвенировали для проверки правильности мутагенеза. Вирусные супернатанты получали, как описано ( 23 ). Клетки S0 трансдуцировали путем спиновой инфекции при 2000 об / мин, 30 ° C в течение 1 часа в покрытых фибронектином чашках с добавлением полибрена (4 мкг / мл) (Sigma).Клетки инкубировали с SCF (100 нг / мл) и интерлейкином-3 (IL-3) (10 нг / мл; PeproTech) в течение ночи перед анализом клеточного цикла.

Нокдаун эксперименты

shRNA, нацеленная на p57 KIP2 (клон SM22685-D-5 V2MM_81921) был субклонирован в адаптированный к LMP (MSCV / LTRmiR30-PIG) ретровирусный вектор, адаптированный к микроРНК, содержащий репортер IRES-GFP) (Open Biosystems). Аналогичным образом, несмолкающая кшРНК отрицательного контроля (RHS4971, Open Biosystems), которая обрабатывается путем эндогенной РНК-интерференции, но не нацелена на какую-либо последовательность мРНК у млекопитающих, была субклонирована в LMP.Отсортированные клетки S0 трансдуцировали ретровирусными векторами, экспрессирующими shРНК в течение 16 часов в присутствии SCF и IL-3. Затем клетки культивировали на Epo ± Dex в течение от 20 до 72 часов перед анализом клеточного цикла.

Количественная ОТ-ПЦР

Общую РНК выделяли из клеток печени плода с помощью набора AllPrep DNA / RNA Micro Kit и RNeasy Micro Kit (Qiagen) и количественно определяли с помощью набора реагентов Quant-iT RiboGreen RNA Reagent Kit (Thermo Scientific). Для обратной транскрипции использовали систему синтеза первой цепи SuperScript III (Invitrogen).КПЦР проводили в системе определения последовательности ABI 7300 с реагентами TaqMan и зондами TaqMan MGB (Applied Biosystems).

Зонды TaqMan

Были использованы следующие зонды TaqMan: β-актин (Mm02619580_g1), β-глобин (Mm01611268_g1), p21 CIP1 (Mm00432448_m1), p27 KIP_m1 ).

Вестерн-блот анализ

Отсортированные клетки печени плода или клетки печени плода из культур размножения и дифференцировки инкубировали в буфере для лизиса [1% NP-40, 50 мМ трис (pH 7.4), 150 мМ NaCl, 1 мМ ЭДТА, 10% глицерин с добавлением ингибиторов протеаз] и вращали при 4 ° C в течение 30 мин. Супернатанты получали центрифугированием при 4 ° C в течение 15 минут и количественно определяли с помощью набора для анализа белков BCA (Pierce). Электрофорез белков проводили с использованием гелевой системы NuPAGE Novex Bis-Tris и гелевой системы Bolt Bis-Tris Plus (Invitrogen). Мембраны поливинилидендифторида зондировали антителами против p57 KIP2 (Abcam ab75974), β-актина (Abcam ab8227), p21 CIP1 (Abcam ab109199), p27 KIP1 (Cell Signaling Technology 3698) (и α-глобина). Abcam ab92492).Полосы целевого белка детектировали с помощью системы ChemiDoc XRS + (Bio-Rad) и количественно оценивали с помощью программного обеспечения Image Lab (Bio-Rad). Отрицательный и положительный контроли использовали во всех Вестерн-блоттингах, состоящих из лизатов клеток 3T3 или 293T, трансдуцированных либо «пустым вектором», либо ретровирусным вектором, экспрессирующим соответствующий тестовый белок.

Расчесывание ДНК

Свежевыбранным клеткам печени плода давали возможность восстановиться в среде, содержащей Epo, при 37 ° C в течение 4 часов. Затем на них воздействовали импульсом IdU (25 мкМ) в течение 10 минут, за которым немедленно, без промежуточных промывок, подавали импульс CldU (200 мкМ) в течение 20 минут.Клетки метили антителами к CD71 и Ter119, как описано выше, и подмножества S0 и S1 сортировали с помощью проточной цитометрии. Отсортированные клетки промывали PBS и заключали в пробки из агарозы (0,75% легкоплавкой агарозы; Bio-Rad). Пробки инкубировали в растворе протеиназы К (0,2 мг / мл; Roche) при 37 ° C в течение 48 часов. После тщательной промывки агарозные пробки расплавляли и расщепляли β-агаразой. Геномную ДНК осторожно ресуспендировали в 0,2 M буфере MES (pH 5,4) и расчесывали на силанизированных покровных стеклах с использованием системы Molecular Combing System (Genomic Vision).Гребеную ДНК денатурировали в 2 М соляной кислоте и метили крысиным анти-BrdU (Abcam ab6326) и козьим анти-крысиным иммуноглобулином G Alexa Fluor 594 (IgG; Life Technologies A11007) для идентификации треков IdU с мышиным анти-BrdU (BD Biosciences. 347580) и Alexa Fluor 488 козьего антимышиного IgG (Invitrogen A11029) для идентификации треков CldU, а также с кроличьим IgG против одноцепочечной ДНК (Immuno-Biological Laboratories Co. Ltd. 18731), конъюгированным с биотином козьим анти-кроличьим IgG (BD Biosciences 550338), стрептавидин BV421 (BioLegend 405226) и IgG человека против BV421 (BioLegend 409317) для идентификации однонитевых волокон ДНК.

Флуоресцентную микроскопию проводили на флуоресцентном микроскопе Zeiss Axioskop 40. Были сделаны отдельные экспозиции для красной, синей и зеленой флуоресценции для каждого поля и объединены с использованием программы обработки изображений GNU (GIMP). До 40 последовательных полей были сфотографированы и объединены в цифровом виде для каждого файла окончательного изображения, которые затем были проанализированы ученым, который не смог определить идентичность образца. Длины треков ДНК измеряли с помощью GIMP. Длины треков IdU представляли собой треки, которые были помечены только зеленой флуоресценцией.Примеры оригинальных флуоресцентных изображений показаны на рис. S9 и в файлах дополнительных изображений. Набор данных электронной таблицы для эксперимента по расчесыванию ДНК на рис. 6 и рис. S7 находится в файле данных S1.

Клеточный цикл и анализ γh3AX in vivo

Беременным самкам мышей внутрибрюшинно вводили 200 мкл BrdU (10 мг / мл). Мышей умерщвляли через 30 мин после инъекции. Печень плода была зафиксирована и проницаема; расщепляется дезоксирибонуклеазой (ДНКазой) I; мечен для включения BrdU, маркеров неэритроидного происхождения и маркеров клеточной поверхности CD71 и Ter119; и проанализированы методом проточной цитометрии.Где указано, клетки метили антителами против γh3AX перед расщеплением ДНКазой I.

Статистический анализ

Односторонний дисперсионный анализ (ANOVA) был использован для сравнения измеренных параметров трех разных генотипов (дикий тип, p57 KIP2 +/− m и p57 KIP2 — / — ) с Программное обеспечение GraphPad Prism 7.0. Статистическую значимость данных расчесывания ДНК оценивали с помощью теста Стьюдента t . Для ненормально распределенных наборов данных использовался тест Манна-Уитни.

Скорость света | Обсерватория Лас-Кумбрес

Сегодня любой может использовать Google для поиска скорости света в вакууме и получить точный результат за секунды: 299 792 458 м / с . Но кто открыл скорость света и как они это сделали?

Галилео Галилей был первым человеком, который попытался измерить скорость света в начале 1600-х годов. Галилей и его помощник стояли на разных вершинах холма с известным расстоянием между ними. План состоял в том, чтобы Галилей открыл заслонку лампы, а затем его помощник открыл заслонку лампы, как только увидит свет от Галилея. .

Используя расстояние между вершинами холмов и свой пульс в качестве таймера, Галилей планировал измерить скорость света. Он и его помощник попробовали это с разным расстоянием между ними, но независимо от того, насколько далеко они были друг от друга, он не смог измерить никакой разницы в количестве времени, которое требуется свету, чтобы пройти.

Галилей пришел к выводу, что скорость света слишком велика, чтобы ее можно было измерить этим методом, и был прав. Теперь мы очень точно знаем скорость света, и если бы Галилей и его помощник находились на вершинах холмов в одной миле друг от друга, свет принял бы 0.0000054 секунд на переход от одного человека к другому. Понятно, что Галилей не смог измерить это своим пульсом!

В 1676 году датский астроном по имени Оле Рёмер изучал орбиты лун Юпитера и составлял таблицы, чтобы предсказать, когда произойдут лунные затмения. Он заметил, что, когда Юпитер и Земля находятся далеко друг от друга (близко к соединению), затмения лун происходят на несколько минут позже, чем когда Юпитер и Земля находятся ближе (почти в оппозиции). Он предположил, что это могло быть из-за времени, которое требуется свету для путешествие с Юпитера на Землю.

Рёмер обнаружил, что максимальное изменение времени этих затмений составляет 16,6 минут. Он интерпретировал это как количество времени, за которое свет проходит через диаметр орбиты Земли. На самом деле он не рассчитывал скорость света, поскольку диаметр орбиты Земли в его время был малоизвестен. Но, используя его метод, зная расстояния, которые у нас есть сегодня, мы получаем значение скорости света примерно 301 204,8 км / с. Это всего лишь около 0,5% от современного известного значения скорости света.

В 1850-х годах французский физик Жан Фуко измерил скорость света в лаборатории, используя источник света, быстро вращающееся зеркало и неподвижное зеркало. Этот метод был основан на аналогичном аппарате, построенном Арманом-Ипполитом Физо. Впервые на Земле удалось измерить скорость света, причем скорость света была измерена с очень большой точностью.

В 1970-х годах интерферометрия использовалась для получения наиболее точного значения скорости света, которое когда-либо было измерено: 299 792.4562 ± 0,0011 км / с. Затем, в 1983 году, метр был переопределен в Международной системе единиц (СИ) как расстояние, проходимое светом в вакууме за 1/299 792 458 секунды.

Ваш комментарий будет первым

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *